Misplaced Pages

This is an old revision of this page, as edited by Pdeitiker (talk | contribs) at 22:58, 21 November 2009 (→Writing Issues). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

This is the talk page for discussing improvements to the Haplogroup R1a article. This is not a forum for general discussion of the article's subject.

Put new text under old text. Click here to start a new topic. New to Misplaced Pages? Welcome! Learn to edit; get help. Assume good faith Be polite and avoid personal attacks Be welcoming to newcomers Seek dispute resolution if needed Article policies Neutral point of view No original research Verifiability

Find sources: Google (books · news · scholar · free images · WP refs) · FENS · JSTOR · TWL

Archives: 1, 2, 3, 4, 5, 6, 7, 8, 9Auto-archiving period: 7 days

	Human Genetic History (inactive)
This article is within the scope of WikiProject Human Genetic History, a project which is currently considered to be inactive.Human Genetic HistoryWikipedia:WikiProject Human Genetic HistoryTemplate:WikiProject Human Genetic HistoryHuman Genetic History

Template:Wikiproject MCB

Archives

Archive 1 Jan 2006 - Mar 2007Archive 2Archive 3

This page has archives. Sections older than 7 days may be automatically archived by Lowercase sigmabot III.

Next round of concerns

PB666 has posted notes directly into the text, after I adapted it in many places today, in an attempt to meet his concerns, so now I'll respond to those:-

• . "Accuracy" tag added to section on Central Asian origins. Comment also made: "not the only problem with that speculation, this section title is a contradiction, which current authors calls it a theory, what aspects of diversity are missing from Central Asia.--Why does " Underhill et al. (2009) took to the data to be consistent with Western Asian origins"." I get the impression that this remark has something to do with some subtle methodological point about the definition of a "theory" as opposed to a "speculation" or something like that? And of course there is the point made previously, that PD wants reference to this theory cut out (even as a non-leading theory) because he feels it is not worthy. But why call this an "accuracy" issue then? Basically this remark is garbled and I need help to understand the point. This is a great example of the real problems now happening on this article. There is no excuse for this way of writing. It is simply showing no big interest in communication.--Andrew Lancaster (talk) 15:40, 13 November 2009 (UTC)

I'll try to pick up the thread of the discussion about this where it occurred above:

1. Version when PD posted first extended comments above:

Cordaux et al. (2004) argued, citing data from Wells et al. (2001), Semino et al. (2000), and Quintana-Murci et al. (2001) that...“Given the high frequency of R-M17 in central Asia (typically 20%–40% ), its rarity in west Asia and its absence in east Asia , Indian R-M17 Y chromosomes most probably have a central Asian origin . ” This position is also considered likely by Mirabal et al. (2009) after their larger analysis of recent data.

2. Our "discussion" at that stage (re-factored with easier indents to follow)...

PB666 yap 00:15, 13 November 2009 (UTC):-

I have the paper right here.

Five groups I will label: 1- Arkangelansk 28, 2- Khanty 27, 3- Koml I 54, 4- Koml P 49, 5- Kurak 40, 6- Tver 38

R* (not M124, R2; not M173, R1) - 1-0, 2-0, 3-0, 4-0, 5-0, 6-0

R1* (not SYR1532.2, R1a1*; not M343, R1b) 1-0, 2-0, 3-0, 4-0, 5-0, 6-0

R1a* (SYR1532.2; not M198, R1a1a*) 1-0, 2-0, 3-0, 4-0, 5-0, 6-0

R1a1a* (M198; not M56, M157, or M64b) 1-5, 2-4, 3-16, 4-16, 5-21, 6-22

Haplotype variance R1a1a* 1- .271, 3 - .226, 5- .191, 6 - .280,

Compare South India - 0.505, South Pakistan - 0.475, West India - 0.426,

This is what I call a 'Daily Show' moment . Based on what data do they affirm the quoted statement?

Ancestral haplotype (R1a1*) in Central Asia. None

SNP variants of R1a1a detected in Central Asia. None

Rank of central Asia types in STR diversity for R1a1a types. Intermediate.

Therefore the conclusion is that R1a1a evolved in Central Asia. Good thinking, completely wrong and out of step with molecular phylogenetics, but who needs that, we are talking about the Y.

Andrew Lancaster (talk) 08:23, 13 November 2009 (UTC):-

Here is what the authors wrote (emphasis added): "Network age estimations from this study suggest that two separate groups exist within R1a1 with similar ages for populations found at the western (Serbia 17.3±5.4) and eastern (South Pakistan 18.7±4.7) poles of the expansion. These results along with time estimates for several other populations across Europe and Asia support the findings by Sengupta et al18 regarding the central Asian origins of the mutation. NETWORK projections also support an Asian origin to this haplogroup, given the plethora of STR haplotypes present in these groups versus those found in European populations (Figure 4a)." FWIW my take on this is that it is a bit like your opinion mentioned below, that we can not distinguish South Asian and West Asian origins. These authors are also saying that we can not really distinguish Central Asian from South Asian either? In any case their words are quite clear, and the summary I proposed for the article is not "vague" but also quite short and clear. The article is also not a "fringe" article by any means. How can we ignore it? You remark about no basal haplotypes is not very convincing because both these authors and readers who know the subject would know that R-M173* haplotypes are fairly widespread, and not yet widely types for M420. Furthermore basal haplotypes are extremely rare in pretty much all places - just singletons and small local clusters - so it is not as if there is a strong case to be made for one part of Asia against another so far.

PB666 yap 15:23, 13 November 2009 (UTC):-

I want you to show me what credible evidence suggest that Wikipedians should promote this point of view as a theory? That is a choice by editors on how they treat this, not the authors of the paper. And BTW we are allowed to critique this based on what other authors have said. Basically a POV has promoted this to a theory, and then failed to adequately critique the speculation, so . . . . .

...so indeed. The most obvious question is whether PD has really considered the changes made now to the passage...

3. Version as it has been adapted today by me:

Cordaux et al. (2004) argued, citing data from Wells et al. (2001), Semino et al. (2000), and Quintana-Murci et al. (2001) that R-M17 Y chromosomes most probably have a central Asian origin. Central Asia is still considered a possible place of origin by Mirabal et al. (2009) after their larger analysis of more recent data. However these authors do not clearly distinguish the case being made for Central Asia for the case being made for Asia, particularly South Asia, more generally.

If this is what PD has really before writing the above, then I do not follow it so far. What the text now says is that one article considered central asia possible but only in a way that they did not distinguish the case distinctly from Asia generally. Is it just a simple case of PD asking a theory he does not like to be removed from view?--Andrew Lancaster (talk) 16:07, 13 November 2009 (UTC)

No, Andrew, you have made your point, it is substantial enough to be kept, however it is controversial enough to also be critiqued and hold a lower status. What is missing in central Asia that Europe has, defining (diversifying) SNPs. What is missing in Central Asia that India has, high STR diversity. How did underhill delineate South Pakistan and India from two populations in Central asia? By age estimates. One might not be faulted for pointing out the first, however considering the last two criteria, failure to mention these increases the POV of the section.PB666  16:19, 13 November 2009 (UTC)

The new version gives it an extremely low status I think, and also it now explicitly casts doubt over whether there is any argument for Central Asia as such, distinct from Asia in general. What more do you want? I honestly do not know what the Mirabal article inserts the term Central Asia, but maybe the authors were thinking a bit like Cordaux was, simply looking at "geometry" like I mentioned above: if you have two poles of recent expansion, then you look in between those poles for any areas that also look pretty R1a rich. Also keep in mind that it is hard to be sure about anything subtle, like paraclades and STR variation, in central Asia given the potential for massive movements and founder effects, as well as no data for Afghanistan or indeed most of Iran. But I am just speculating. The point is that:

• they did use these words,
• these are not fringe authors,
• this is not an old article.--Andrew Lancaster (talk) 16:30, 13 November 2009 (UTC)

• . "Accuracy" tag added to Phylogeny of R1a section. Comment also made: "Removing newly defined SNPs which makes clades look closer together is a POV edit. We either can choose to place no mutations in the cladograms or place all mutations, cherry picking mutations is POV". I can reply to this very simply that this is simply normal procedure. EVERY Y haplogroup can be distinguished by large numbers of equivalent SNPS. As has been discussed before the exact number of these does not reflect an accurate measure of age gaps because there has not yet been enough standardized sequencing to know if we are comparing apples with apples. Many SNPs are just found by change while looking at something else.--Andrew Lancaster (talk) 15:40, 13 November 2009 (UTC)

If R1a1a page existed, in the Haplogroup box it is customary to add all the defining, mutations since you have decided to scrap the page, the onus is still on you not to loose or hide this information. If you choose to hide the information then it becomes a criteria for creating a new page, since you find it normal procedure to delete this information, it is thus normal procedure to create a new page to prevent information from being lost and allow a balanced consideration of the information. On which of the E1b1b or subpages have you suppressed defining mutations (doesn't seem to be normal procedure there)? Even on the E1b1b1a page you have mentioned all defining mutations. In addition, the removal of the R1a1a cladogram also removed one of the subbranches, which I see as a form of information suppression. The M334 mutation is as important as any other R1a1a mutation.PB666  16:28, 13 November 2009 (UTC)

I think you simply do not realize how many mutations are known, and how randomly they are discovered. You are simply wrong about this. The E1b1b article does NOT show all the phylogentically equivalent SNPs, and neither does any article I can think of! For example where we mention M173 in this article should we mention "M173/P241, P225, P231, P233, P234, P236, P238, P242, P286, P294"?

It is not only normal procedure, it is also absolutely necessary. You would need to insert dozens of SNPs all over the place in all the Y haplogroup articles. I want to point out that already with all the M17/M198s I have been adding all day, you are forcing this article now in the exact same bloated direction which you have criticized so often when you've remarked on articles that have been a victim to edit warring. Nonconstructive editing tends to push other editors into putting in more words than necessary and not focusing on more important stuff. --Andrew Lancaster (talk) 16:37, 13 November 2009 (UTC)

I am very much aware that fact, this is something I keep reminding you of, but to say the least more defining mutations is better than fewer. Do you consider the article, at this moment, to be bloated, if so add comments to the comments section as to why. See section below:

Andrew, I would remind you that 'argument from ignorance' anti-logic as a precept for 'absense of evidence is not evidence of absense' logic generally does not improve by removing information. one doesn't need to place M17, M198, ..., ..., everywhere in the article. However, in the phylogenetics section you can state Currently, 7 mutations () distinguish R1a1 from R1a1a however only two mutations M17 and/or M198 are used in Y-DNA typing to define the M1a1a subclade (M1a1 in older literature). The same can also be done for R1a1, in this way you are not hiding information, but at the same time you are not bloating the article. As per working to re-add M17 and M198, that improves the accuracy, but in terms of readability I would recommend in parentheses adding (R1a1a), that is the nomenclature that is most picked up when _I_ read the article and so I am biased to wanting an accurate phylogenetic tag. If this does not upset you greatly I will add the tag myself for clarity.PB666  17:44, 13 November 2009 (UTC)

Two things. Concerning finding solutions by putting notes about the notations and assumptions once only, this is the direction I thought we were going until you went massively unilateral. Concerning the superscript, I make no conclusion yet. To me it does not seem obvious for a normal reader at first sight.--Andrew Lancaster (talk) 19:55, 13 November 2009 (UTC)

A prescript might be better, for example R1a1a. BTW there are not that many outstanding issues to get this article to a class-B status, if we put our elbow-grease into this it could be done by Monday. Higher class articles are easier to protect by Administrative action relative to low class articles. Something to think about.PB666  20:24, 13 November 2009 (UTC)

What's wrong with using something that will make sense to any person with a reasonable education and reading skills like "R1a (M17/M198)" or "R1a (old)"? You sure are keen on jargon.--Andrew Lancaster (talk) 20:31, 13 November 2009 (UTC)

Old is relative, remember the point of still mutations missing, which happens when the next round of SNP hunts is done and there are only a month left in 2009!, (famous last words). I would desire a tag that is specific for a current version. Jargon is good; sometimes, it keeps us honest, if one places a specific tag and then spews speculation, that is a leverage point by which we can correct the persons POV. The problem I have with R1a M17/M198 is that it is two nomenclature revisions from current status. I would fell much better with R1a1a (M17/M198), again, this is my opinion watching HLA for the last 25 years, nomeclature only seldomly reverses itself. For example the B*0701 allele was not occupied when found to be an erroneous sequence of B*0702, they simply retired the number. In the immediate sense, if you want to use R1a1 (M17..) or R1a1a (M17 . . .) either is fine.PB666  20:51, 13 November 2009 (UTC)

BTW there are not that many outstanding issues to get this article to a class-B status, if we put our elbow-grease into this it could be done by Monday. Higher class articles are easier to protect by Administrative action relative to low class articles, we would have to worry less about the bannable pests if we establish clear goals and meet those goals, reversion becomes much more justifyable. Something to think about. In terms of bloating, the article went from a size of 90 kbts to is current 53 kbts, actually smaller when we consider text. However, the impetus should be on increased wikification of the article with appropriate graphics to make it more attractive to a general audience, while this is not a requirement for class B articles given the dry nature of the topic, it is really helpful. Concerning the split, I think the jury is still out on the issue, but recent actions have deferred its necessity. I think you will see future actions to split the page, and if this is your dislike, the I would certainly make sure the split-reasoning is minimized to its lowest level without belt-busting the article.PB666  20:51, 13 November 2009 (UTC)

Concerning the need for superscripts I see that your ideas are focusing on a hypothetical future, so lets watch for it. Personally I think mutational names will take over. Concerning "R1a1a (M17/M198)" the article is now full to bursting with such stuff. Anyway, if we have common sense, like we have generally had between us, we'll always find a way. Concerning classification systems I do not want to criticize you for doing something that needed to be done bypointing out that you are effectively citing yourself here, but on the other hand it is not what drives all good faith Wikipedians. B class would be good but there is no WP:deadline, particularly when you have other stuff to do also.--Andrew Lancaster (talk) 21:09, 13 November 2009 (UTC)

Andrew, I have a deep dark secret to tell you, so secret that just the words may burn your ears for a wwwwwhhhhhhhooollllleeee millisecond. Misplaced Pages:WikiProject Human Genetic History - particants - Andrew_Lancaster (Shhhhh quite, keep it to yourself, burn you CRT and throw it in a live volcano). Your such a super secret member you forgot to tell yourself. That does entitle you to make comments about HGH articles and judge the merits of the Article by the standards. More importantly, the-powers-that-be at Misplaced Pages (whom I can name but you can find a reference on my user page) would like it very much that you did comment on articles and did rate articles.PB666  00:14, 14 November 2009 (UTC)

Please read what you reply to before you write rude replies. I said I have no problem with you doing ranking work per se, but that I find the discussion style odd (to say the least) when a person in the middle of a disagreement about an article goes out, makes rankings and then immediately starts posting remarks on talkpages where he is in disagreements, citing those rankings as if they were done by someone else. --Andrew Lancaster (talk) 13:47, 17 November 2009 (UTC)

Status change

Do to recent edits on the main page and in concert with the comments I made on 14 October 2009 and 22 October 2009 (listed here), most of the problems on the main page that prevented this article from being promoted have been satisfied (and I still have a few hairs left on may head to boot). I am promoting this article to C-class, since the two remaining issues are dealing with how to handle the most recent literature. If anyone has any comments that they think would demote the page back to a start class or changes need to promote the article please place the there. I do not want to be seen as 'raising the hoop' Ad libitum. Since these recent criteria have been passed I think the page should be promoted. The attention needed tag has also been removed. Congratulations.PB666  17:14, 13 November 2009 (UTC)

Other tasks available. WP:WikiProject_Human_Genetic_History/to_do. Please take some time to scan the article for grammatical and spelling errors.

The article meets the nine B-Class criteria when:

1. The article is suitably referenced, with inline citations where necessary.
2. It has reliable sources, and any important or controversial material which is likely to be challenged is cited.
3. The use of citation templates such as {{cite web}} is not required, but the use of <ref></ref> tags is encouraged. . I am working for producing a database of Harvard tags and citations in the WP:HGH page. You can store formal citation tags there for future use. Also Now that the Diberri tool is back on line, it would be nice to see those full citations again. Note the Diberri tool which has a Cite Web template can be easily converted to citation template by rearranging the authors names |last1 = |first1 = |last2 = |first2 =. This combines the ease of using Diberri with the improved (in text Harvard referencing) referencing of the citation template.
4. The article reasonably covers the topic, and does not contain obvious omissions or inaccuracies.
5. It contains a large proportion of the material necessary for an A-Class article, although some sections may need expansion, and some less important topics may be missing.
6. The article has a defined structure. Content should be organized into groups of related material, including a lead section and all the sections that can reasonably be included in an article of its kind.
7. The article is reasonably well-written. The prose contains no major grammatical errors and flows sensibly, but it certainly need not be "brilliant". The Manual of Style need not be followed rigorously.
8. The article contains supporting materials where appropriate. Illustrations are encouraged, though not required. Diagrams and an infobox etc. should be included where they are relevant and useful to the content.
9. The article presents its content in an appropriately accessible way. It is written with as broad an audience in mind as possible. Although Misplaced Pages is more than just a general encyclopedia, the article should not assume unnecessary technical background and technical terms should be explained or avoided where possible.

I should also note on the HGH page I removed R1a (Y-DNA) from articles needing immediate cleanup and attention. However it has been moved to Wikify, this is a reminder that graphics would be nice.PB666  18:43, 13 November 2009 (UTC)

I do not wish to be negative about your good intentioned and positive efforts to start grading genetics articles, but let's all please be a bit more clear. You have recently been grading these articles yourself, so when you cite the grades, you are just citing yourself. Please make it clear when you are doing so, especially when it concerns articles where you have been editing yourself. Now you are giving rules also but what is the source of these criteria, for example the preference concerning citation method (which oddly seem like your personal preferences)? I note how you have even explicitly pointed to my name. Here is what I see on the appropriate Misplaced Pages page:- the six B-Class criteria:

1. The article is suitably referenced, with inline citations where necessary. It has reliable sources, and any important or controversial material which is likely to be challenged is cited. The use of citation templates such as {{cite web}} is not required, but the use of Cite error: There are <ref> tags on this page without content in them (see the help page). tags is encouraged.
2. The article reasonably covers the topic, and does not contain obvious omissions or inaccuracies. It contains a large proportion of the material necessary for an A-Class article, although some sections may need expansion, and some less important topics may be missing.
3. The article has a defined structure. Content should be organized into groups of related material, including a lead section and all the sections that can reasonably be included in an article of its kind.
4. The article is reasonably well-written. The prose contains no major grammatical errors and flows sensibly, but it certainly need not be "brilliant". The Manual of Style need not be followed rigorously.
5. The article contains supporting materials where appropriate. Illustrations are encouraged, though not required. Diagrams and an infobox etc. should be included where they are relevant and useful to the content.
6. The article presents its content in an appropriately accessible way. It is written with as broad an audience in mind as possible. Although Misplaced Pages is more than just a general encyclopedia, the article should not assume unnecessary technical background and technical terms should be explained or avoided where possible.

Notice the differences? Who is the source of the changes, and in particular the ones which say "Phil's referencing method is better than Andrew's"? I presume some sections of what you present above as Misplaced Pages guidelines are actually your personal notes about them? Looking to the Misplaced Pages guidelines as I have just quoted them, my own opinion is as follows...

1. The article is suitably referenced: DONE.
2. The article reasonably covers the topic, and does not contain obvious omissions or inaccuracies. DONE
3. The article has a defined structure. DONE
4. The article is reasonably well-written. DEBATABLY DONE: certainly not brilliant, but certainly reasonable.
5. The article contains supporting materials where appropriate. Illustrations are encouraged, though not required. Diagrams and an infobox etc. should be included where they are relevant and useful to the content. COULD BE BETTER BUT DONE
6. The article presents its content in an appropriately accessible way. It is written with as broad an audience in mind as possible. Although Misplaced Pages is more than just a general encyclopedia, the article should not assume unnecessary technical background and technical terms should be explained or avoided where possible. PROGRESS HAS BEEN MADE TO THE POINT WHERE IT IS DEBATABLY DONE

I do not demand others to agree with my opinion, but opinions are being called for I take it.--Andrew Lancaster (talk) 13:00, 14 November 2009 (UTC)

For ease of reference, here is the previous discussion PB666 and I (and others) had about how to reference this exact type of article: . Note that this discussion also touched upon the last criterium for quality mentioned above (accessibility), and also note the last sentence of the discussion where I wrote "A hybrid system where different parts of the article work different ways is a poor system". This point was a PRACTICAL point which was very similar to the concerns recently raised by the unilateral article split: making a major edit which PARTIALLY rebuilds the whole structure of an entire article and then demanding other editors to finish off the work, simply does not work in practice. You end up with a mixture of structures. See quality criteria above about structure. In other words, every proposal about an article's basic structure or referencing system should ALWAYS take into account that the structure should be easy to maintain for editors in the future.--Andrew Lancaster (talk) 13:11, 14 November 2009 (UTC)

Andrew, I agree with that, however again, the writing style is if you are going to drop the names of 5 different authors in two sentences such that the subject of the sentence changes into 'who the hell are all these authors' the reader looses. Two footnote/citation system is great, however, one critique, the replacement of Doe et al. for a list of coauthor names does not exactly comply with citation standards. If the referencing is distracting from the topic, and the footnoting method does not, use the footnote. Many articles have both ar reference section and a further reading section and so I don't see having to sections as a problem. This is wikipedia, not a paper journal, we like to wiki-link in the friendliest and easy way possible. Put your reader first is a general rule for article promotion.

I know the difficulty in using the Harvtxt/Citation template, that is why I think we should keep a database of frequently cited articles, for example Mirabal can be used on 5 different Y-DNA pages. Lets try, whenever possible, to comply with conventions. This is my only outstanding problem with the references other than the gargantuanly long note.

I am going to repeat myself because it appears not to be clear, the Harvtxt system, when used properly is completely acceptable, see Mitochondrial Eve, however the authors of the template admit there is a known bug that makes referencing difficult. Ergo one has to be extremely careful when creating the references. I have a critique that we are using {{Hartxt|Doe et al.|2009}}, when it should be {{Hartxt|Doe|Smith|Jones|Chan|2009}}. I had the hardest time trying to get your method to work until I scrapped it went to Citation, downloaded the citation form went to Harvtxt and selected the appropriate template. That is the source of the problem, its not very user friendly and what you have done is created alot of half-assed citations. I don't think most wikipedians would judge this to be a problem for class B rating. But I found a much-much easier way, a way if you tried it you would be pleased. I am trying to help you out here, not criticize you, I appreciate the Harvard referencing system as it has some advantages, but it has a major bug, so that we need to be clever about how we use it.

Most of the papers we deal with are cited on Pubmed and have Pubmed IDs. These can be placed into the following:

Bberri template filler (or as many in WPMed refer to it, a godsend). Where I simply cut the PMID off the Pubmed abstract or search-resluts page, past it into the text box next to and click, You have a fully formed ((Cite journal)) reference. This takes about 6 seconds and replaces a couple of minutes of typing. Next I replace ((cite journal | .... in the reference with ation and now you have a citation,if you do nothing more it will work, however if you want it to work with Harvard Referencing templates you will need to modify the name stream._{{Citation and now you have a citation, if you do nothing more it will work, however if you want it to work with Harvard Referencing templates you will need to modify the name stream. Replace the list of authors | author = with |last1 = Doe |First1 = J |last2 = Smith |first2 = J |last3 = Jonese |first3 = B| last4 = Chan |first4= J|. . . . . This is a little work, however I just then cut and past the names into {{Harvtxt|]|]|]|]|2009}} and walla, beautiful, complete, accurate Harvard Citation capable citations. I assume you misunderstand what I was saying above and so I am not going to pester you about this anymore. (although I spent several hours trying to figure it out just to see things from your point of view, can this really improve articles). And that is the bottom line, too much of a good thing is too much of a good thing (Master Pi), highly dense use of harvard referencing is not encyclopedic it can be a distraction. I would argue one other thing, linking an article once per section is adequate, multiple linkings increase the size of the article, WP:MOS indicates to limit same Wikilinks to 1 or few per page. Within a section if a person has a Harvtxt link for a paper and one references the author a second time, non-hyperlinked Doe et al.(2015) is fine.PB666  19:32, 14 November 2009 (UTC)

Anyway that's good enough for me, B-class it is. Lets try to keep it there.PB666  19:58, 14 November 2009 (UTC)

B-class articles have some reward. Portal:Molecular_Anthropology------>Portal:Molecular_Anthropology/Selected_article (Also hint: This as a lead?) PB666  21:12, 14 November 2009 (UTC)

So your point is just about the "et al" instead of listing all authors? The Harvcoltxt template will work if you put in all the authors in the Citation template in the references section, so why not simply improve the citations in the reference section rather than arguing that there should be lots of footnotes instead of Harvard templates?--Andrew Lancaster

Too much caffiene I suspect is the problem here. No don't replace harvard references, unless they are junking up a particular passage, else leave them alone. No good reason, no replace. I should point out, in the mt Eve article I replaced footnotes with Harvard references, so.....PB666  00:22, 15 November 2009 (UTC)

I put in a lot of references which work properly by all standard norms, using both the Harvard citation template and the ref format, and these allow people to find the names of all authors anyway.--Andrew Lancaster

1. It sets a bad precedence,

2. Some references may not have a pubmed or Doi link, in those cases the full author list may help finding the article or parts of the article on the internet and library searches.

3. Below you argue we should stick to the Geographic standards, OK we should stick to the reference standards

I don't think you have a cogent counter argument, simply griping cause I complained about the reference quality.PB666  00:22, 15 November 2009 (UTC)

I have never had the pleasure of seeing other editors, including you, helping to add in anything more than one or two wrongly formatted refs that are needed in any genetics article I have been working on.--Andrew Lancaster

Dog hand bite feeds. Where exactly did you get U2009, Mirabel, OK, so . . . . . .PB666  00:22, 15 November 2009 (UTC)

I spend an enormous amount of time putting them in already and see it as a job which might otherwise simply would not be done at all. So lets please be a bit realistic.--Andrew Lancaster (talk) 23:04, 14 November 2009 (UTC)

And I showed a relatively easy way to get that same product, better. So why are you griping, have you tried it. I am hearing this argument here 'I did alot of work, it worked for me, no-one else did squatilly, I'm perfect, don't criticize me' argument.

I will time it for you. From the beginning of the search until the full reference. 6:01 PM to 6:02:15 {{cite journal |author=Underhill PA, Myres NM, Rootsi S, Metspalu M, Zhivotovsky LA, King RJ, Lin AA, Chow CE, Semino O, Battaglia V, Kutuev I, Järve M, Chaubey G, Ayub Q, Mohyuddin A, Mehdi SQ, Sengupta S, Rogaev EI, Khusnutdinova EK, Pshenichnov A, Balanovsky O, Balanovska E, Jeran N, Augustin DH, Baldovic M, Herrera RJ, Thangaraj K, Singh V, Singh L, Majumder P, Rudan P, Primorac D, Villems R, Kivisild T |title=Separating the post-Glacial coancestry of European and Asian Y chromosomes within haplogroup R1a |journal=Eur. J. Hum. Genet. |volume= |issue= |pages= |year=2009 |month=November |pmid=19888303 |doi=10.1038/ejhg.2009.194 |url=}} 6:03:22 to 6:06:10 reformat reference. Underhill, PA,; Myres, NM; Rootsi, S; Metspalu, M; Zhivotovsky, LA; King, RJ; Lin, AA; Chow, CE (2009), "Separating the post-Glacial coancestry of European and Asian Y chromosomes within haplogroup R1a", Eur. J. Hum. Genet., doi:10.1038/ejhg.2009.194, PMID 19888303 {{citation}}: Unknown parameter |month= ignored (help)CS1 maint: extra punctuation (link) CS1 maint: multiple names: authors list (link) 6:07:09 to 6:08:07 Underhill et al. (2009) done. ~5 minutes, filled three different templates. Now, as you say, I have never added a reference to a 'damn article', how is it that it only takes me a few minutes to come up with a full harvard reference of the latest article and the footnote version? BTW, where did you get that article from. Misplaced Pages:WikiProject_Human_Genetic_History/Mt-DNA. Here is an example of a featured article in which I have made major contributions Coeliac_disease, do you see a single reference that is Doe et al., Cause its going to seem like a damn shame that other Wikiprojects core articles are promoted to feature article status, but we are not able to promote articles beyond a certain level because our foolish pride gets too easily hurt. Stop whining - man up.PB666  00:22, 15 November 2009 (UTC)

Stop assigning pointless jobs to people. And stop trying to force the issue of assigning jobs by starting a job and leaving articles half changed. Please just accept that not everyone agrees with your opinions on every little matter of format.--Andrew Lancaster (talk) 08:34, 15 November 2009 (UTC)

you are not arguing with me, you are arguing with Misplaced Pages, and when it comes a time which you desire your favorite page to be promoted, don't be surprised if they ask, why do all you citations in the list begin with et al. Every single last one of them. I am pointing this out to you and I don't believe that at some level, it is useless. Be stubborn if you want. If you want to do a real test, since this is newly class-B article, lets see how it takes to get promotion to GA status. - Misplaced Pages:Good_article_nominations#Biology_and_medicine- PB666  17:58, 15 November 2009 (UTC)

OK, you just nominated it. So what? I must say this is the weirdest new way of pushing a position I have seen. Can you please stop citing yourself in third person? It is confusing.--Andrew Lancaster (talk) 22:48, 17 November 2009 (UTC)

South West Asia vs. West Asia

Hey Pdeitker I know you prefer SW Asia as well but are you saying West Asia is a Misplaced Pages (WP) standard? I'm just not following the whole logic behind the stance. Usually in the field of Geography the Middle East is referred to as South-West Asia rather than West Asia. Even archaeologists who specialize in Middle Eastern archaeology will refer to their area of speciality as "South-West Asian archaeology". West Asia is still rather ambiguous/confusing. Geog1 (talk) 21:11, 13 November 2009 (UTC)Geog1

Well, your right its more intuitive, what does everyone else think, maybe we can alter the wiki-standard. When I think of West Asia I think of the Ural mountain region to the Caucasus. Andrew pointed out last night that that was a grossly horrific and terrible to have. lol. However if you type Southwest Asia you are redirected to this page. Some terribly important Wiki-Cabal has decided that this is the case as it should be.PB666  00:04, 14 November 2009 (UTC)

Geographic terms have certain Misplaced Pages policies. We need to pick the most commonly used and easy to understand name, and yes preferably it should link to the most relevant article. Is Middle East perhaps the most clear?--Andrew Lancaster (talk) 12:46, 14 November 2009 (UTC)

Review of structure

A while back we split the article into two sections, BOTH of which go through the full range of geographical regions - first just discussing the distributions and the second concerning origins and migrations theories relevant to those areas. Although this might sound odd, it cleaned up the flow of thought a lot because previously the migration theories had been mixed together in a confusion of raw data and original thinking. NOW, I note that there have been some small edits which are causing the Middle Eastern DISTRIBUTION section to become a bit disorganized. It also means the section is starting to cover migration theories. PB666 just made this remark also so he also noticed it. In the long run we might want to consider reviewing the structure, but only when someone is ready to change it fully and not leave the job half done.Andrew Lancaster (talk) 14:44, 14 November 2009 (UTC)

Split, Split, Split, Split, ra, ra, ra.PB666  18:56, 14 November 2009 (UTC)

For the time being my advice is that people should always be careful about pasting in snippets into sentences bit by bit. It makes sentences longer and longer. It is better to look EVERY time at whether the sentences also need to be rearranged in order to avoid them becoming bloated. Always check to make sure how your edits FIT.--Andrew Lancaster (talk) 14:44, 14 November 2009 (UTC)

A related problem that I see has now developed is that PB666 has forced a whole new phylogeny section into the beginning of the origins section, and then apparently unaware of the irony he has posted a note in the original phylogeny section pointing out that it is redundant! I can see how it is tempting to start an origins section with a phylogeny discussion though, just as I can fully understand why editors want to make sure the interesting case of Iran gets full discussion, and so this problem also raises the question of whether the origins section should be re-merged into the other sections - with this new phylogeny discussion moved to the other, and each migration section merged back into the relevant geographical distribution sections.--Andrew Lancaster (talk) 15:57, 14 November 2009 (UTC)

The solution you provided is adequate, it separates the problem of R1a origins at the beginning of the page, and thus allows R1a1a origins not to be hindered by the confusion dilemma. Although structural I think it belongs in the Origins section, origins sections by HGH standards are typically at the front of the article, and it is now were it should be, however it is not named as such.

Although I did not change the cladogram, for comparisons sake and because in some papers, like Sharma et al. the do discuss R1* that is neither R1b and R1a indicating that the elimination style cladistics is throwing, potentially, M420 positive SRY1532.2, negative into mish mash clade, also it gives me a way of tiddying up that section of the page and adhere to the new suggestions for cladistic style. Now if you want to critique the approach, find out what Sharma et al. typed, because they found R1* in many places in India, but Underhill found no R420 positives in India. Its possible the R1* in Europe is 2009 R1a* and R1* in India is R1c, R1d, etc. IOW, a mish-mash clad R1a monophyletics and paraphyletics. The basic arguments in this group have largely stemmed from bad nomenclature, tis it not nice that we have mitochondrial DNA, sequence the entire genome and be done with it.PB666  18:56, 14 November 2009 (UTC)

The above is a comment to a remark on your talkpage, not here. It is confusing that you post on my talk page AND here. Can I suggest anything about a particular article should be on the article talkpage, and responses should be near what they are responding to, or perhaps linking to them? Here is how I responded to a similar message on my talkpage: How can any reader possibly understand that this is the logic behind putting a mutation in the OLD phylogeny which was NOT KNOWN in "OLD phylogeny" times?????? If we can put in ghost clades for ones not yet discovered then maybe you should put a few in the new phylogeny also? If you are going to have a special diagram to show what people USED TO THINK, why criticize the diagram for not being up to date?? I want to also make a comment: You constantly write as if it is obvious that you are the only person who understands the literature and everyone else is a confused idiot. Are you sure about that?--Andrew Lancaster (talk) 22:53, 14 November 2009 (UTC)

Point one, if its article related - like please change this, it should have been posted here first. So that would be your fault (and BTW, pedantic). If you want the latest online copy of Sports Illustrated Swimsuit edition, it belongs on a talk page (and in case your wandering, I don't have it). Point two, we are talking about Y-chromosome, the dirty stray little dog of molecular anthropology, what I understand is irrelevant because the literature will change tomorrow. The better we can point to the faults of the methods used, the better we have informed the reader. Stop beachin.PB666  23:36, 14 November 2009 (UTC)

No I am not being pedantic. Once again you are simply not believing it when people say that your way of communicating is confusing. As far as I can tell, it is simply not your priority to worry about this. Concerning point 2, this is not a response at all.--Andrew Lancaster (talk) 08:30, 15 November 2009 (UTC)

The M420 you put in the tree is not even in the right place!--Andrew Lancaster (talk) 08:40, 15 November 2009 (UTC)

It is, in fact, in the right place, it precisely depicts what you described in the text, however if what you wrote was wrong, and I don't think that it is, then we can change it, but don't go reverting images to a poor quality previous version without some discussion. And the version was restored and improved, Andrew you have been leaving inappropriate comments in the history section, you are very emotionally tied up in what you are doing and the last few edits you have made have not improved the article, I suggest you back off, work on another page or something else until your head cools a little.PB666  17:51, 15 November 2009 (UTC)

That's a tremendously unconstructive response. I think it is obvious that:-

• There was quite a big attempt to discuss, but you are not even trying to understand what is written to you.
• M420 is in the wrong place after your new revert, for the obvious reason that it shows M420 as a sibling to SRY1532.2 whereas it is a parent!--Andrew Lancaster (talk) 13:20, 17 November 2009 (UTC)

Gee wilikers, you got it, that why its an obsolete cladogram, that's why we should be using the new nomenclature in priority over the old nomeclature. The cladogram is in error to show the error in the previous nomenclature. You ever seen one of those adds on TV with the old fat lady standing next to the picture of the buff/plastic surgery version. Its called a contrast. What I have done is contrasted the old (wrong) version with the new (right) version, because the text you have written is less fun than getting wisdom teeth pulled without an anesthetic. Of course we all know that given the sorry state of Y-cladistics, there will probably be shown problems with the new clade as some future point. But that is unimportant. Prior to revamping this page we just had to have inserted the latest, super-duper, R1a paper, well we got that paper. And based on that paper the old cladistics which was known to be flawed, but why it was flawed:

M420 mutation which was ancestral to R1a but descendant relative to R1 was being sorted as R1*, presumably a sister clade of R1b and R1a. This indicate critical deficiencies in the cladistic efforts regarding molecular systematics and clocking. With the new cladogrom M420 uncovered, it moves between R1 and R1a, where it should be.PB666  20:13, 17 November 2009 (UTC)

After all these many discussions it is apparent that you want to treat the old cladistics as equivilant to the new cladistics. If so I ask one question: why did we need to wait for underhill, we could have just done the article with the wrong cladistics. Either its important or it isn't, if its important to keep the material how cladistics evolved, then I think its important to keep the cladogram showing how that undetected mutation was improperly sorted. Simple as that. Now, of course if you could clean up the text, remove the jargon, make it understandable to mad-dogs and englishmen, then I will think about whether we need to be showing the position of the misplaced mutation. Until such time, I think readers like myself would greatly prefer looking at the cladograms to tell the story. And BTW, that is the name of the game at this point, clean up the massively concentrated jargon within the associated text. I am working on the Lead, when it appears that you want to involve yourself in making the article more encyclopedic we can talk about how to better structure the very limited graphics on the page. PB666  20:13, 17 November 2009 (UTC)

• In your patronizing response above, as usual you do not deign to both explaining your own positions. What exactly is wrong with the graphic you reverted from?
• If my wording is strong and clear, this is because discussion with you is such a one-sided effort, and clearly not because I am emotionally attached to any content, and it is tendentious of you to make such accusations. Please check the facts. No particular facts or theories are being debated between us, and concerning format changes I've been happily allowing massive changes except in specific cases where I explain my concern (and then you do not read what I write).
• If people want to see examples of someone getting emotional about their sunk costs on this article, look on my Talkpage and PB666's loopy tirades.--Andrew Lancaster (talk) 13:20, 17 November 2009 (UTC)

Other people trying to follow the discussions about this article will surely find it even more difficult than me, because there are bits and pieces all over the place. Concerning the cladogram question, people trying to follow will need to see this prior discussion, dropped as usual, just before PB666 went into unilateral mode without trying to understand the point... http://en.wikipedia.org/search/?title=User_talk:Pdeitiker&diff=325814200&oldid=325801439 , http://en.wikipedia.org/User_talk:Andrew_Lancaster#Cladogram --Andrew Lancaster (talk) 19:32, 17 November 2009 (UTC)

Yes and why did you post that there instead of on this page, as I said you complained about the scattered discussion, but you actually triggered the scattering. Stop whining.PB666  20:13, 17 November 2009 (UTC)

I am simply posting links to the discussion.--Andrew Lancaster (talk) 20:55, 17 November 2009 (UTC)

Regarding GA nomination

I noticed that this article has been nominated -- I'm not quite ready to sign up to review it, but thought I would give my first reaction. It seems to me that the article is not accessible to a broad enough class of readers. It is easily possible that a reader interested in anthropology will come to this article, but such a reader won't be able to make sense of it, and doesn't get any guidance toward the necessary background. The main background needed is to understand the special features of inheritance of the Y chromosome, and what a haplogroup is. Most of the related Misplaced Pages articles are totally unreadable for non-specialists -- the genetic geneology article is the most helpful, so a pointer to it would be a start. The best thing, though, would be for this article itself to sketch the basic facts that a reader needs to know. Looie496 (talk) 18:50, 15 November 2009 (UTC)

Thank you for your input. This has been my feeling all along. The jargon needs to be removed, and the article needs to be made accessible to the average reader. (See my comments above.) Some editors have done a good job in inserting the science. Now the language needs improvement. MarmadukePercy (talk) 19:17, 15 November 2009 (UTC)

Thanks for the quick reply.PB666  02:04, 16 November 2009 (UTC)

opening of phylogeny section: the odd obsession with naming all SNPs

After several days of posting increasingly insistent notes within the text, saying that there should be some introductory sentence for the phylogeny section, PB666 has inserted some text. I have whittled it back a lot for what seem to me to be very straightforward reasons, which are given in the edit notes. If someone sees an error in my thinking, please let me know. Here is what is left:-

I also want to remove or change this part but it needs more explanation. PB666 has been making a lot of comments about the SNP which distinguish different clades, arguing for example that not mentioning all known ones would be "suppression" of information. The factor of the matter is, as I have explained before, the number and names of the SNPs we know are random chance and not important. There will be hundreds, but papers just mention the first ones that are found. More systematic research is needed before you can read much into them. So looking at the above passage I think it is very odd. Why are active verbs like "produced" and "altered" being used to describe mutations which are not causes but effects? Why is it being emphasized that "4 known SNPs" did the altering in one case?--Andrew Lancaster (talk) 14:00, 17 November 2009 (UTC)

I don't understand what part of known which you do not understand. Second off, if there are 100s of mutations then surely you have proof or precedence, otherwise there are simply an unknown number of mutations alongside the known number of mutations. We don't have to present on Misplaced Pages what we do not know, only what is known and important.:I stongly suggest, if you want to find faulty in the clarity of the article, please look at the section directly below, in Different meanings of "R1a". I am going to continue to revert the cladogram until you have cleaned up the jargon and lingo in this section, because it is an alternative for people who do not want to trudge through. Again, I repeat the effort is being made to satisfy the comments of an outside reviewer regarding jargon, we have the B-class, but we need to focus on improving this article, not only for this article sake, but as a standard which we should strive to improve all the Y-DNA articles, all which fall at or below the level of this article. The target should not be battling heads with Phil, the target should be reaching out to readers. Specific comments regarding the minutia of this article at this point are of lesser importance.PB666  19:31, 17 November 2009 (UTC)

I am obviously working on whatever I think needs work. I have done my best to explain each thing I change, which is something you do not do, and indeed your comments and edits continue to demonstrate that you are not even thinking about what you are reading. It is called good faith editing. Your demand that I ignore problems that you are not willing to discuss is not valid. Your threat to edit war if people are disobedient to your demands will not work. I have told you what is wrong with the cladogram. If I am making a mistake tell me, but do not tell me that "I am going to continue to revert the cladogram until you have cleaned up the jargon and lingo in this section to satisfy the comments of an outside reviewer". If your own personal priority is to write with less jargon you sure have an odd way of showing it.--Andrew Lancaster (talk) 20:53, 17 November 2009 (UTC)

I have told you three times, the final time above. The cladogram is not intended to be factually correct, its intended to show the contrast in placement of Y chromosomes before mid-2009 and after mid-2009. If the old cladogram was perfect there would be no need for new systematics.PB666  21:00, 17 November 2009 (UTC)

I do not recall you saying that the cladogram is not intended to be factually correct. But anyway, it makes absolutely no sense at all to use this as an argument for keeping it! The old cladogram people used before 2009 was not wrong. It just contained less information because some thing had not been discovered. To pretend that people before 2009 were all making a stupid and impossible mistake, putting M420, a mutation they did not know, in the wrong place in the tree, is nonsense. Why would they have imagined it was in the wrong place in the tree?--Andrew Lancaster (talk) 21:09, 17 November 2009 (UTC)

Andrew, you are as you continue to be in a very argumentative mode, which I have found after years on the UseNet makes no sense to continue discussing, either you approach the problem with an open mind and clear head or we cannot further discuss this.

Whether or not they could detect M420 or not is immaterial, M420 was monophyletic with SRY1532.2 relative to R1b and R1(else); however, by placing them in the R1* category they were treating ancestral versions of R1a (meaning versions intermediate between R1 and SRY1532.2) as being paraphyletic or underived, that is an error in assignment, if you don't want to call it an error then certainly it was a fault, which means it fell short of what phylogenetics desires. The critical error in these works which you fail to place on the page is that they have not done true sequence comparisons between clades, for example R1a1a* and any R1b*. That is part of explaining why there is differences to the layman. Since you don't want to do that I created a cladogram that implies that is what is going on.

Unlike other forms of geneology such as mitogenomics, human Y-chromosome is not generally sequenced. As a consequence errors can be made in the phylogenetics. One such error has been detected in 2009, when SNPs in the lineage between R1 and SRY1532.2 and should have been treated within a single subclade of R1(for example the current definition of R1a) were place in both the R1* clade and R1a (see 'gray' M420 cladogram on right). This indicated that certain R1* had no defining mutations or defining mutations that belong to other clades, but actually belonged in the R1 to R1a lineage. As a consequence of the placement error the R1a* clade needed to be recently redefined. M420 bearing R1 were placed into R1a and R1a (SRY1532 positive) shuffled to R1a1 and R1a1 (M17 positive) moved to R1a1a. Consequently, the subclades of R1a1 (R1a1a to R1a1d) were renamed R1a1a1 to R1a1a4. On this page the modern nomenclature will be used however older nomenclature will be noted, when appropriate.

Consequently the methods they are using are prone to the error which I described and illustrated. The authors are not self-critical of their approaches, however as editors we can be, and we can contrast errors in Y phylogenetics with haploids that are sequenced, like mtDNA. When mtDNA work was largely done with D-loop region major misplacements were made, many times, now that the genomic sequencing was done, such misplacements are rare and of minor significance. You are very hesitant to take a NPOV on the problems with Y geneology, instead you keep pointing the finger at the critic, myself, that I misunderstand the problem. I clearly understand the problem and think that it should lead the definition section so that the user can go forth through the article in understanding the confusion that half-done genetics causes.PB666  21:39, 17 November 2009 (UTC)

The most important point is, for example, reading Sharma et al. 2009 in which the R1* clade is concerned, the reader of that paper does not know whether those detected as R1* (Not R1b) belong in the R1 to SRY1532.2 lineage or in another lineage. IOW paper that do not type M420 are combining mutants that are monophyletic with R1a with mutants that are paraphyletic with R1a. And so yes, it is an error. In addition as I pointed to Underhill and Sharma. Underhill detects no R1* in India, and Sharma finds R1* in many of the same populations that Underhill tested, indicating a contradiction. IOW while R1a* (old) may be comparable to R1a1* new, R1* may not be comparable with R1a* new indicating areas were false conclusions might erroneously be drawn. For example whether or not R1a (SRY1532 negative) is found in India.PB666  21:39, 17 November 2009 (UTC)

If you label something as the pre 2009 phylogeny, it should be that? Just please answer that?--Andrew Lancaster (talk) 22:38, 17 November 2009 (UTC)

I'll put it another way. The diagram you keep reverting states clearly in graphical form that experts in this field before a certain date believed a certain thing about a mutation M420 which was wrong. Actually they did not know this mutation existed. They said nothing about it either right or wrong. Also they allowed space for it's possibility. It came as no shock. In other words they did not predict that M420 would be discovered but different that it turned out to be. You are simply fabricating the facts.--Andrew Lancaster (talk) 22:46, 17 November 2009 (UTC)

1. Whether or not a pilot knows that his aircraft is going to crash does not change the fact that the aircraft crashed, even if the pilot is aware of the fact that the airplane can crash under the circumstances that the airplane crashed, he can still be faulted for crashing the AC. In[REDACTED] we can discuss the fact that the airplane crashed and the fact the pilot was unaware of the fact because of a misconception. So that particular logic you use is not important. They were at fault. I am not fabricating facts, that has already been done, I am analyzing the source of error, which you refuse to do.
2. The only correct critique you have made so far is this: Also they allowed space for it's possibility. But if we think about this objectively a clock is right at least twice a day. The R1* designation is actually a composite of different possibilities (or to state otherwise potential mixtures of monophyletic and paraphyletic phenomena)

a. Y-DNA representing the unique common ancestor of all R1

b. Y-DNA representing new true subclades of R1

c. Y-DNA that are monophyletic with unique mutations in the R1-R1a

d. Y-DNA that are monophyletic with unique mutations in the R1-R1b

IOW, its an ill-defined phylogenetic bag. Why is it an ill defined bag, because a clearly approachable technique, sequencing, with clearly approachable comparators, R1-anything (outgroup) R1b and R1a can be sequenced and all the defining mutations done. Its the same as a pilot failing to read the NOTAM properly and accidentally using the wrong navigational aid. It may not appear to be a fault to you, but it is a fault.PB666  23:22, 17 November 2009 (UTC)

They were not "at fault" and they did not believe M420 was in the place where you put it, and neither do people believe it now. You "old phylogeny" is from an alternative universe. To use your plane analogy it is like making a diagram of how a plane crashed which never did crash. Please give a source for your "old phylogeny".--Andrew Lancaster (talk) 06:54, 18 November 2009 (UTC)

When you come to a point in which you can be reflective about the faults in the Y genetic geneology, then you might be able to write and argue that which is understandable by the common reader. Until such point that you continue a stance of defending that which is flawed, you will have difficulty explaining why the faulted needed to change, and you will continue to defend jargon that is confusing instead of offering nomenclature that clarifies and helps to organize the article. Arguing with me will not clear up the section that you wrote. PB666  15:05, 18 November 2009 (UTC)

This section Different meanings of "R1a" is the most jargonistic section of the article. If you take the time to write it out more carefully, put things in notes that don't need to be in the main text (like Page07=rs######) and keep new jargon to less than a couple of items per sentence, then if I can sit down and read through it an not be confused or distracted by the Jargon, then I might revert the image. If I have to come back and do this, am I going to end up doing it for all (Y_DNA) articles. You called me into mediate your conflicts, instead I found train-wrecked pages that are the true source of the problem, the training period is over, its time to fix these things yourself.PB666  15:05, 18 November 2009 (UTC)

I do not see it the same way. First, I believe I have been removing jargon quite well, a job I do not claim that I ever got to finish, and you have been inserting it just as rapidly in the midst of unreadable part-sentences. It might be "personal" but it is obviously important to point out that I think it is clear now that what you find readable and good style is nothing like what most people find readable. In other words you are NOT an authority on that subject. Sorry. Please let other people clean up the English. Secondly, I would like to be allowed to once again edit Misplaced Pages rather than negotiate with you constantly about your deadlines, threats to edit war, and insistences upon personal preferences. You are making it very difficult. Thirdly, yes of course everyone agrees that the article was a mess at the time I asked you to look at some issues on it, but since then positive work on this article had been progressing at a reasonable speed until the moment you started making your major unilateral changes and your demands to other that they should clean up after you in ways specified by you. If this continues to be your main contribution to the article then obviously it is not positive.--Andrew Lancaster (talk) 15:25, 18 November 2009 (UTC)

Again, these protracted discussions only point to the fact we are not whole-hearted about improving the article, only arguing about improving the article. This is going to be reflected on by the articles referees. Secondarily, yes you were offended by dead-lines, but no, despite the claims the article was improving, it was improving at a snails pace. And third, I actually muffled my discontent with the jargon because I felt to say more was overburdening. You don't seem to get this process, there is no I in we, I don't expect my edits to last, what I have done is to provide the impetus and fodder for improvement. If you claim MarmadukePercy is such a wonderful English copy editor, we need to get the article to a point that those edits will be obvious. I have noted that really sorry articles in Misplaced Pages are seldomly copy-edited. We, collectively, have to bring the little factoids here to a grammatical and wiki-standard in which a copy-editor is going to be able to turn our wall-flowers into a portrait. Jumping all over bold edits is not going to get us there. The complaint is the article is full of jargon, but you and I both want content that someone of both your and my level would find useful. That means we double the task, because not only do we have to provide this content, but we have to make it accessible to newbies. There is much more than just words, there are diagrams, images, etc that are required.PB666  01:38, 19 November 2009 (UTC) Lets show these referees that we can work together, and that we will listen to what they say and try to pre-empt comments by improving the article before the reviewing process begins. Trust me, there will be alot of comments, they may even wonder how the article was promoted.PB666  01:38, 19 November 2009 (UTC)

Suggested replacement for the lead

haplogroup R1a is the name given to a major human Y-chromosome haplogroup within R1 (R-M173). In other words, it is one of the major male-lines of all humanity. It is found at high frequencies in a wide geographic area extending from South Asia to Central and Eastern Europe and Southern Siberia.

R1a is believed to have originated somewhere within this same area in Eurasia, most likely in the area from Eastern Europe to South Asia. R1a, R1a1, and R1a1a are defined by single-nucleotide polymorphisms named M420, SRY1532.2 and M17, respectively. So far, 8 sub-clades of R1a1a are known, however only three subclades are known to have significant frequencies R1a1a3, R1a1a6 and R1a1a7.

R1a has been found in high frequency at both the eastern and western ends of its core range (e.g. in some parts of India and Tajikistan , and Poland on the other) and both ends are dominated by R1a1a. The highest frequency level observed in any large population so far has been found in some South Asian groups. On the other hand, until 2009 claims regarding the oldest R1a bearing populations varied greatly between different articles. Some of the older articles supported origins in Central Asia and Europe. In 2009, two large studies of available data concluded that there are two separate "poles of the expansion" with similar ages, with South Asian R1a1a older than European R1a1a. Both articles felt the data to be most consistent with Asian, as opposed to European origins for R1a1a, and, in particular, South Asian origins.

-End suggested lead.PB666  19:31, 17 November 2009 (UTC)

For contrast here is the current version...

Haplogroup R1a is the name given to a major human Y-chromosome haplogroup within R1 (R-M173). In other words, it is one of the major male-lines of all humanity.

It is found at high frequencies in a wide geographic area extending from South Asia to Central and Eastern Europe and Southern Siberia.

R1a is believed to have originated somewhere within this same area in Eurasia, most likely in the area from Eastern Europe to South Asia.

Can you explain what your aims are? All of what you are adding here is discussed in other parts of the article right now?--Andrew Lancaster (talk) 20:46, 17 November 2009 (UTC)

WP:Lead The lead section, lead (sometimes lede), or introduction of a Misplaced Pages article is the section before the table of contents and first heading. The lead serves both as an introduction to the article and as a summary of the important aspects of the subject of the article.

• The lead should be able to stand alone as a concise overview of the article.

- The current version does not stand alone for example as per good article or featured article.

• It should define the topic, establish context, explain why the subject is interesting or notable, and summarize the most important points—including any notable controversies.

_ the current lead does not.

• The emphasis given to material in the lead should roughly reflect its importance to the topic, according to reliable, published sources, and the notability of the article's subject should be established in the first sentence of the lead, if possible.

• While consideration should be given to creating interest in reading more of the article, the lead nonetheless should not "tease" the reader by hinting at—but not explaining—important facts that will appear later in the article. The lead should contain no more than four paragraphs, should be carefully sourced as appropriate, and should be written in a clear, accessible style to invite a reading of the full article.

- the current lead does not.

PB666  20:56, 17 November 2009 (UTC)

I am looking hard but not one of those recommendations says that the lead should be padded with material duplicated from the main article. Can other editors please give opinions?--Andrew Lancaster (talk) 20:58, 17 November 2009 (UTC)

The previous lede is better than the proposed revised lede. (That said, the previous lede could use some work too.) The lede in any piece is not designed to be stand-alone. Yes, it should give a summary of the piece, but it is not designed to be freighted or overloaded with all the minutae that will follow. It should be clean and readily understandable, and as much as possible, avoid the trap of adding too many technical terms. They can follow in the main piece, and should then be adequately explained for readers, but stuffing it all into the lede makes it ponderous, leaden and offputting. MarmadukePercy (talk) 21:19, 17 November 2009 (UTC)

No, According to WP:LEAD - "The lead should be able to stand alone as a concise overview of the article." In its current form it does not, if I thought my version was a suitable replacement I have no fear of WP:BOLD. Ergo both should be merged and tweeked. PB666  21:50, 17 November 2009 (UTC)

Major sections leads should also do the same for their sections. Concise overviews by themselves should, when combined and cropped, be easily fashioned into the lead. Is there anyone here who has ever worked on a good article or featured article?PB666  21:53, 17 November 2009 (UTC)

FYI, there are editors here who have worked on essays and articles every bit as valid as anything on wikipedia. Quit making personal attacks and insinuations and lecturing people about[REDACTED] parliamentary points-of-order, and engage. MarmadukePercy (talk) 03:11, 18 November 2009 (UTC)

You stated something incorrect, FYI, and I corrected you. If this article has so many experienced Wikipedians why was it such an insufferable piece of crap and why was it listed as needing attention. Or the better question to ask with all those experienced Wikipedians that love this article, why is it that this and 50 other Y-DNA articles are in such miserable shape. Judge the tree by the fruit it bears. There is apparently a very hard lesson being learned here, it is amazingly more difficult to put the reader first than it is to fill an article with opinion. When we can get over this hump in understanding, you guys will stop arguing with me and start going about wikifying articles and making the more encyclopedic. Time wasting arguing with me does not a good article make. If you and Andy don't like my proposal, sit down and hash out a better one. I am just trying to comply with the outside critique.PB666  05:05, 18 November 2009 (UTC)

I stated nothing incorrectly. Let's cut to the chase. The reason this article is 'such an insufferable piece of crap,' as you put it, is because you attempt to handle the whole thing yourself. Perhaps you know something about genetics. You don't know the first thing about language. I know little of genetics, but quite a bit about language. The way to make these articles work is for each contributor to seize on his strengths – and admit his weaknesses. You're trying to do it all, even though there are areas where you're not competent. If you want this piece to be more than "an insufferable piece of crap," then you need to collaborate with others who are better at some things than you are, and perhaps not as good at other things. End of story. MarmadukePercy (talk) 03:20, 19 November 2009 (UTC)

PD, neither Marmaduke nor I were responsible for older versions of the article. We have been working on it recently, like you. Right now proposals are being made and explained by others, so lack of proposals is not the problem. The problem is that most work is now being blocked by the personal tastes of one editor, who has decided to take control and cite his own opinions as Misplaced Pages policy. Your definition of the blockage is effectively saying that everyone should start obeying you. As usual in Misplaced Pages, this approach does not work.--Andrew Lancaster (talk) 07:03, 18 November 2009 (UTC)

To put it very kindly, there is at least nothing obvious about your preference in the guidelines you state. To me it just looks padded and eccentric, but that's just me personally. Other people will have other opinions. So please make the case about WHY you think one version is doing the job better than the other, rather than just asserting your preference to be "the rules".--Andrew Lancaster (talk) 22:36, 17 November 2009 (UTC)

There are at least two things that the following articles have in common Wind, Fungus, Zelda_Fitzgerald, Trial_by_Jury, DNA, On_the_Origin_of_Species. Each of the give a well written and ample overview of the article, each of these is a featured article. Here is an article about the same size as ours.

The Cretaceous–Tertiary extinction event, which occurred approximately 65.5 million years ago (Ma), was a large-scale mass extinction of animal and plant species in a geologically short period of time. Widely known as the K–T extinction event, it is associated with a geological signature known as the K–T boundary, usually a thin band of sedimentation found in various parts of the world. K is the traditional abbreviation for the Cretaceous Period derived from the German name Kreidezeit, and T is the abbreviation for the Tertiary Period (a historical term for the period of time now covered by the Paleogene and Neogene periods). The event marks the end of the Mesozoic Era and the beginning of the Cenozoic Era. With "Tertiary" being discouraged as a formal time or rock unit by the International Commission on Stratigraphy, the K–T event is now called the Cretaceous–Paleogene (or K–Pg) extinction event by many researchers.

Non-avian dinosaur fossils are only found below the K–T boundary, indicating that non-avian dinosaurs became extinct immediately before, or during the event. A very small number of dinosaur fossils have been found above the K–T boundary, but they have been explained as reworked, that is, fossils that have been eroded from their original locations then preserved in later sedimentary layers. Mosasaurs, plesiosaurs, pterosaurs and many species of plants and invertebrates also became extinct. Mammalian and bird clades passed through the boundary with few extinctions, and evolutionary radiation from those Maastrichtian clades occurred well past the boundary. Rates of extinction and radiation varied across different clades of organisms.

Scientists theorize that the K–T extinctions were caused by one or more catastrophic events, such as massive asteroid impacts (like the Chicxulub impact), or increased volcanic activity. Several impact craters and massive volcanic activity, such as that in the Deccan traps, have been dated to the approximate time of the extinction event. These geological events may have reduced sunlight and hindered photosynthesis, leading to a massive disruption in Earth's ecology. Other researchers believe the extinction was more gradual, resulting from slower changes in sea level or climate.

Notice that they are using the lead to explain very complex terminology used in the article while at the same time overviewing the article. Consider topics covered in the article R1, R1a, R1a1, R1a1a, R1a1a6, R1a1a7. Consider terminologies used in the article SNP, STR, Coalescent time, diversity, distributions. Consider concepts raised in the article, Pliestocene migration, Mesolithic migration, Neolithic Migration, Kurgan Migration, Bronze Age migrations. Given the support for any object or concept one may or may not place these in the lead, but if one provides no adequate coverage of the major ideas and section topics, one is not providing a good quality lead.PB666  05:22, 18 November 2009 (UTC)

The text you proposed simply has none of the virtues you claim for it. Sorry. People simply do not agree with your taste on these matters.--Andrew Lancaster (talk) 06:56, 18 November 2009 (UTC)

pb666 going for it

This edit is a revert insisting on calling a mutation "page07" which is clearly a reference to a page number in an article being referenced in a source. To use it here in Misplaced Pages we'd need to explain this very indirect referencing. As it happens we do not need to, because the article being referenced to provides Table S5, which gives standardized rs numbers for this and other mutations:

Table S5: Description of R1a associated SNPs

M417 rs17316771 R1a1a* G to A 283 153 TGCAGAAAGAAGAGGAGGACAGCCATGTGTAGTTGGGGGACCACATCC 21

M420 rs17250535 R1a* T to A 275 26 GGCAAACTTTTCATTGCTGG CTAAAAAAACTTAACCCATCACAC 21

M448 rs17222202 R1a1* T to A 317 107 GTGAGAAAGAGAAATGCCAGG GACATACATCCTCTGTTCCC 21

M449 rs17306692 R1a* C to A 317 138 TCAACCAACAATTTGCAACCC TCTGTGAGCAAGGTGACAGC 21

M459 rs17316227 R1a1* A to G 316 149 TGAAGATGCAAAACCAGCACG CAATAGTCTCACAAGAGAAGAAATG 21

M511 rs17307677 R1a* T to C 322 264 GGATGAATTGATGAAGAGATGT CTCAGAGAAAAGACATTTCAG 21

M512 rs17222146 R1a1a* C to T 356 161 TGTTCCTCTGTGAGACTGAGC CAGAACCATGTCATATCAGG 21

M513 rs17222573 R1a* A to G 319 137 GAGATCTTCACTGTCCTTTTTAC GTGTATTTGAAATGGTTCAGGTG 21

M514 rs17315926 R1a1a* C to T 377 245 CTTTTTCCTTATGACAAGATTTC GAATACCTGTTGTATCTTAGC 21

M515 rs17221601 R1a1a* T to A 233 112 GTATTGTCCATATAAGGTCTCTG CCAAAGTGCTGGAATTACAGATG 21

M516 rs17307105 R1a1* A to G 263 173 CTTCTGAACATAAGTGTTCAGG AGTCTGGTTTTGGTTAAAAGC 21

none rs17250901 NT A to T 380 272 AGAAGAGATTTCTAGCCAGAGT GGGGTAGAAAATTATTGGTC 21

Page07 rs34297606 R1a1a* C to T 333 62 CTGACCCCTGACTCCAAGCA AAAAAAGAAAATGGGGACTCACTG 22

Page68 rs34351054 R1a1a8 C to T 340 41 AGAATTGCTTGAACTCTCAGAC GAGATACCTGGAGGTGAGAAG 22

M334 unassigned R1a1a7a C to A 499 356 CCTTGGCATTTTGTTTGGGCTGG AAAGGGGGCCTGAGTGAGCACT this study

M434 unassigned R1a1a6 G to A 325* 213 CCAAAATTAGTGGGGAATAGT GATCACCCAGGGTCTGGAGTT this study

M458 unassigned R1a1a7* A to G 283 87 AGAAGAGATTTCTAGCCAGAGT CCAGAAAAAAATAATTCCTGGA this study

I would like other editors to please comment on whether they see me making any gross errors, or perhaps I am just editing emotionally as per the repeated accusations of PB666?--Andrew Lancaster (talk) 22:59, 17 November 2009 (UTC)

I agree the names is silly (screwy as I referred to it) however That is what underhill called it in the main text of the article. I am not asking you to call it Page07 or Page68, these two mutations are defined by a third party, what if they called it rs34297606, then simply reference the third party and use the rs tag.PB666  23:07, 17 November 2009 (UTC)

Let me clarify what I am asking you, Underhill uses on version in the main text, but he refers to mutations documented by another group Repping et al. Repping et al appears to have used R1a* as their reference sequence see figure 2. (I should state for clarity since someone around here has a tendency to blow things all out of proportions, by 'appears' I mean it is not certain that this is R1a* or some other R1 but the reference sequence was an R1*). One of the authors of the paper has the last name Page (David C Page, HHMI Cambridge, Massachusetts), so that the mutation may be named after the author, that may be its common name. Again by precedent we are not using rs####### nomenclature. I was asking you, before you changed it, to look up the nomenclature and confirm the rightness or wrongness of your assumption. PB666  00:51, 18 November 2009 (UTC)

PB666, the above passage quoted in full shows that the rs nomenclature is used by Underhill. He also mentions these mutations in the review article he wrote with Kivisild. The rs nomemclature is a recognized standard and we have not discussed any "precedent" which says otherwise. Your speculations on the authors surname are not important here.--Andrew Lancaster (talk) 06:50, 18 November 2009 (UTC)

PB666 has replied, or not really replied, on his talkpage as follows, starting by quoting me:- "The rs nomemclature is a recognized standard and we have not discussed any "precedent" which says otherwise. however true that may be, that is not what you have been using in your articles, IOW you personally established a precedence, by changing that precedence ad lib may confuse the reader and will make the article more jargonistic. You have not given a good reason yet for changing the name, you are only trying to cover up the fact that you made a possible missassumption about the origin of the name (a page, versus the proper name Page), and I consider this bad faith."

I want to point out how simple the situation is:- the rs name and the "page" name both occur in the Underhill article, but only one of them is a known standard name which is easy to look up for anyone. The very fact that we can have different theories about what the "page" means is kind of indicative of the problems with that particular name. The mutation's rs name has appeared in other articles by Underhill for example.--Andrew Lancaster (talk) 15:45, 18 November 2009 (UTC)

To respond to this point and this point only. We need fewer standards not more, we are already interchange R1aX with M###, to add yet another level to this would only increase the confusion. We are not bound to use all versions that Underhill uses, only the versions which are most encyclopedic, and i don not think rs####### are appropriate for use in an encyclopedia if other nomenclature is available. And there is one key indicator of which standard we should be using: not all properly named markers have assigned rs########, but all rs###### have proper names. This suggests that we should, at least for the moment adhere to the proper names and leave the 'non-redundant genomic DNA identifiers' for molecular engineers who read these paper, which, by the way, I am one. Anyway, I left Andrew with a more appropriate option, that is to move the non-essential mutations to a reference notes and thus he can assign, if he needs to, rs tags to properly named mutations.PB666  01:41, 19 November 2009 (UTC)

I agree with your principle, but not your supposed way of achieving it. We should have fewer standards, and the most standardized standards, and the simplest possible referencing. So on this basis, why are you always insisting on the opposite in practice? The "Page" reference is not a normal standard and does not look like one. The rs numbers are normal standards, and they look like standards. No one will need to make theories about where they come from, nor look up a footnote. A standard is a standard. You do not have to be a molecular engineer to see that the rs number is a reference number, just like "M420". It is nothing more. It contains no "molecular engineering". Terms like Page08 are on the other hand not clear to you, me, or anyone else. Please be reasonable. Your proposal to make a footnote is odd given that you claim that you are trying to make things simple.--Andrew Lancaster (talk) 06:38, 19 November 2009 (UTC)

PB666, I see you are still pushing this . Your whole approach to this question seems strikingly inconsistent and eccentric. I want to point out a fwe very simple things:-

• Your edit comment says that "Still Andrew has not justified this exception to the nomenclature used in the clade". Is that really true? Look above. I see your argument changing. I see answers to every concern you come up with. I see no final response from you.
• Your original reason for this preference of yours was very clear: "rs34297606 is not given by underhill, he uses Page07 either use what they use or provide the reference for rs34297606" . As you know, I was able to show that this is not true. The referred to article does use this name, as do other articles such as this one, which has the virtue of being an important review article of the whole field: Underhill and Kivisild (2007), "Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing Human Migrations", Annu. Rev. Genet., 41: 539–64, doi:10.1146/annurev.genet.41.110306.130407
• A new element to your complaint is that this nomenclature is "an exception". It is not even clear what this means. Page07 is very obviously also an exception. We have no "M" number for this mutation which we can cite.

Can you explain your approach?--Andrew Lancaster (talk) 08:33, 20 November 2009 (UTC)

And again . Comment this time: "Stick to one naming convention". Which convention are you referring to? Is Page07 within some convention? If so, is it the same convention as the other mutation names in this article?--Andrew Lancaster (talk) 13:43, 20 November 2009 (UTC)

Response to Small Victory/Sophian

1. Underhill used these ("Page07" and "Page68" named after Redding et al. author Dr. Page) in his figure along with 5 other proper names, R420 being one. He did not use the rs tag. Why do you think you are more qualified than he is to determine the proper label?
2. I asked you to confirm what the original author, Redding named it, you did not confirm.
3. I read the redding paper. Page is a coauthor. The mutation is not named after a page, I read all of the supplimentary materials, there is no Page 7 or Page 68.
4. We (you largely since you're going alone editing now) are not using the rs######## labels for any other SNPs. In fact you are using R-M### as part of the clade names and section heads, increasing the reasoning
5. rs####### are unencyclopedic names, this is an encyclopedia, not your personal desk reference.
6. It adds one more level of nomenclature we do not need.
7. If we were to convert to rs####### there are Underhill described mutations that lack rs numbers.
8. You keep messing up the cladograms which I carefully edited to have them match borders.
9. While you have been editing these you have made changes that have changed labels and shifted formats, indicating that you do not know what you are doing.
10. If it is required I will crop an image of Underhills figure so that it can be place here for others to see as well as an image of the pdf showing the authors name. Since the blood pressure in yours eyes has obstructed your sight.PB666  23:08, 20 November 2009 (UTC)
11. I gave you the option of using footnotes to reference this jargon off the main text, so that the material would not be lost, you refuse, and you clutter both the cladogram and main text with unnecessary text, when shorter less jargonistic text will suffice.

Neolithic/CWC Again

Actually I think Kasperaviciute (2004)is suggesting that the R1a MAY have spread during the time of the CWC based on level of differentiation compared to Y chromosome N. Andrew when you "debutchered" that section did you look at the right study? Maybe I pasted the wrong reference but I think there are two different Kasperaviciute studies. Geog1 (talk) 15:34, 18 November 2009 (UTC)Geog1

Hi Geog1, yes I looked at it, but the article mentioned many types of aging and migrational possibility. Certainly the words I changed did not match it, but there might be another way to mention it there.--Andrew Lancaster (talk) 15:41, 18 November 2009 (UTC)

Two talk subpages

I have created two subpages to hopefully streamline revision of this article.

1. Proposed Lede

See my notes there.--Andrew Lancaster (talk) 09:06, 19 November 2009 (UTC)

1. Since there is an ongoing discussion on my talk page on how best deal with the jargon in the Phylogeny (Family Tree). I have moved the proposals to this page as it is more appropriate. Proposed Nomenclature.

I have started discussion about the proposed lede for this sub-section below, on this talkpage. For the other sections, I'll start work over there.--Andrew Lancaster (talk) 10:00, 19 November 2009 (UTC)

Update. Discussion on this supposed draft did not go ahead. After I posted extensive remarks, PB666 expressed frustration that I would take the draft so seriously, explaining that the actual "wordage" would need to be altered, but that "This was supposed to be me assisting you toward improving that section of the page, not vice versa I did not want to put this much work into this, I was simply trying to point the direction". "I would hope that you will take the initiative at this point The page will not self-improve if you also do not self-improve". On his talkpage he has gone much further: "my focus is on improvement not discussion It could almost be interpreted that by excessive points of discussion you might want to obstruct the improvements or replacement of your text, is this your intent?"

So the summary is that this was not a draft in the normal sense, nor in the sense described when PB666 proposed that people should make remarks on these pages which would lead to an ever improving version. These were just examples for other people to think about, as a kind of education by PB666. My personal opinion on this approach, and the responses I eventually received is quite negative, but at least things are clear now about this draft page.

Looking forward concerning the phylogeny section of the article, it is however inexplicable to me that PB666 is saying that all he wants is for me to do the editing, and that he does not have time for it. His actions seem to show a very different direction.

I should point out that in contrast, concerning the lede draft page, PB666 has engaged in some level of discussion.--Andrew Lancaster (talk) 09:23, 20 November 2009 (UTC)

I would invite everyone to offer changes, however I would politely asked that their be restraint from ad-hominim attacks, or derogatory comments, and that the effort should be in editing, not harassment. If you see a spelling or grammar error, fix it. If something is missing, add it, if its too much remove it.PB666  02:41, 19 November 2009 (UTC)

This exercise is pointless repetition UNLESS you make some attempt to explain to others, in a convincing and specific way, and indeed avoiding ad hominem, what problems you see yourself as improving with your proposals.--Andrew Lancaster (talk) 06:57, 19 November 2009 (UTC)

Other editors please participate in this discussion? I have noted comments below and on two of the draft pages mentioned above.--Andrew Lancaster (talk) 21:27, 19 November 2009 (UTC)

Going through your draft:

Phylogeny (Family Tree)

Current version of section lede:

The most recent publications on this subject have increased knowledge of the complexity of the R1a. It has been shown that by far the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Each major branching of this tree has a corresponding set of known (as well as unknown) SNP mutations which can be used to test individuals as well as the links between branches as more information becomes available.

Your proposed version?

The most recent publications on this subject have increased knowledge of the complexity of the R1a. It has been shown that by far the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Each major branching of this tree has a corresponding set of known (as well as unknown) SNP mutations which can be used to test individuals as well as the links between branches as more information becomes available. The genetic markers SRY153.2 and M17 are the most commonly tested markers for R1a. Recent work has shifted their placement in the tree relative to the R1 parent clade. In addition new clades of grouped with M17 have been identified that have significant distributions.

So (you should be explaining) you seem to want to lengthen this lede. Why? (And please do not say that ledes have to be long according to Misplaced Pages policy.) All the information being mentioned here is discussed in no significant extra amount of detail very close to this same lede section, so this is simple repetition, and not summarization. For example compare these:-

• Sentence you want to add: The genetic markers SRY153.2 and M17 are the most commonly tested markers for R1a. (Note: use of present tense, but we are describing the past? These markers are now seen as markers for clades within R1a. Your wording does not exclude this possibility, but it is unclear. Also note mistyped mutation name.)

Thanks, corrected typo. The passage was added for M420 with more editing. (un-signed comment by PB666)

• Sentence already nearby: Prior to 2009 the mutation SRY1532.2 (or SRY10831.2) defined R1a, and this is also ho

w the term R1a is most often used in publications before 2009.

Sentence had been edited out. (un-signed comment by PB666)

• Sentence you want to add: Recent work has shifted their placement in the tree relative to the R1 parent clade. (Note, this description of the shift is wrong or at least unclear. R1a remains rooted to the R1 clade in the same way as before, or that's how it could be described.)

True, but insertion of branches logically shifts their position outward, of course in reality only or perspective has shifted, "known phylogenetic tree added but simpler lingo is desired. (un-signed comment by PB666)

The problem is that we could find the right words to explain exactly what has changed, BUT that is exactly what the aim of the below section is, and nothing more. You are moving all content into the lede!--Andrew Lancaster (talk) 07:57, 19 November 2009 (UTC)

• Sentence already nearby: In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".
• Sentence you want to add: In addition new clades of grouped with M17 have been identified that have significant distributions.
• First please re-write the sentence so that it means something. Note: if you insert something like this in the main page, someone will probably either remove it, or else try to save it and perhaps make it worse by trying.

It seems to me that when you edit you are not trying to keep in mind what is already written in the article. When changing one place, you need to keep the structure and flow of discussion and avoid sending the reader in new directions, or repeating things excessively. You are doing this both in your main page editing and on talk pages, and if you stopped doing it, I really think all this extra discussion would be un-necessary.--Andrew Lancaster (talk) 07:20, 19 November 2009 (UTC)

And consider that you drafted a version in mid-edit.

This un-signed comment by PB666, but please also note that he (confusingly) also edited the texts in my above post! I am trying to adjust it so that this can be followed. PB666's new version is here:---Andrew Lancaster (talk) 07:57, 19 November 2009 (UTC)

The most recent publications on R1a have greatly increased knowledge of the complexity of the R1a. This research demonstrates that the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Two lower branches of the R1a tree have a corresponding set of known 'mutations', called SNPs, which can be used to test individuals and improve classification. The SRY1532.2 and M17 SNPs are the most commonly tested markers for R1a. Evaluation of a new marker, M420, has shifted their placement in the known phylogenetic tree relative to the R1a's parent clade. In addition, new clades, which group with M17, have been identified, and at least 2 have significant distributions.

— PB666 next draft

• Sentence you want to add: Evaluation of a new marker, M420, has shifted their placement in the known phylogenetic tree relative to the R1a's parent clade.

Please note that this is confusing English. The reader needs to search for what "their" refers to, but it refers to two "markers". This is a mixed metaphor: markers are being moved about on trees. Furthermore, as mentioned above the wording "shifted their placement in the known phylogenetic tree relative to the R1a's parent clade" does not have a clear and precise meaning for people who do know this field. You could equally say that the position has not changed at all. As mentioned above, The problem is that we could find the right words to explain exactly what has changed, BUT that is exactly what the aim of the below section is, and nothing more. You are moving all content into the lede!--Andrew Lancaster (talk) 08:03, 19 November 2009 (UTC)

Ledes are for layman, so I don't have a problem with a slight dumbing down, at that point; however, it should be avoided in the subsections. As for their, I see your point, I don't like to use the word and will find a way around it.

It has been reorganized and wordage has shifted, or un'shifted'. Some aspect of the content should be in the lede, the key word is aspect, as in not a full disclosure, but a sample.PB666  08:42, 19 November 2009 (UTC)

The most recent publications on R1a have greatly increased knowledge of the complexity of the R1a. This research demonstrates that the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Two lower branches of the R1a tree have a corresponding set of known 'mutations', called SNPs. Evaluating these for cases typed as R1, R1a's parent clade, improves classification. The SRY1532.2 and M17 SNPs have been the most commonly tested markers for R1a. Evaluation of a new marker, M420, has altered our knowledge of the placement of SRY1532.2 and M17 within haplogroup R1. In addition, new clades, which group with M17, have been identified, and at least two have region specific distributions.

— PB666 after next draft

PB666, this discussion is not functioning yet unless you read what people write and ANSWER IT. You have demanded a lot of time and effort from fellow editors, under threats and deadlines, and I have once more given detailed remarks, which include some very basic problems with what you are proposing. You have not answered me at all, apart from fixing some of the most obvious mistakes. Most importantly, you need to explain what is worse about the versions you are replacing, and what is better about your proposals. You need to explain your aims. Are you just proposing change for change's sake? For what its worth, your explanation above, or what can be understood of it, seems to have nothing to do with the reality we live in. You say you dumbed down the lede, but you did not. You made it longer, and far more complex and difficult to read without adding anything of value that I can see. --Andrew Lancaster (talk) 09:50, 19 November 2009 (UTC)

Y-DNA haplogroups by ethnic groups

The above article has been listed for deletion. The discussion is at Misplaced Pages:Articles for deletion/Y-DNA haplogroups by ethnic groups. Wapondaponda (talk) 04:22, 19 November 2009 (UTC)

An example of the problems with this piece

Can anyone tell me what this paragraph means?

"The naming systems commonly used for this haplogroup remains inconsistent in different published sources. Although it has not yet used much in published surveys, the most comprehensive survey of the known mutations is listed by ISOGG, and an equivalent tree is given in Underhill et al. (2009). Prior to 2009 the mutation SRY1532.2 was commonly used to identify "R1a". This is also how the term R1a is most often used in publications well into 2009. However the term "R1a" is increasingly used to refer to a broader family. This includes the "old" R1a and certain lineages within R1* that have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2 moves from "R1a" to "R1a1"."

This is the sort of verbiage that chokes scientific mags but that[REDACTED] should cut at all costs. It is a hindrance to readers. One shouldn't expect readers of an encyclopedia to know what ISOGG is, much less be impressed by the reference. Most of this piece needs to be translated into everyday English -- and that's assuming the underlying science is correct. It's also as important that the grammar be correct as the science: 'naming systems' is plural, so the verb should be 'remain' and not 'remains.' These are not small considerations, and should receive equal weight in a piece designed to be literate. MarmadukePercy (talk) 05:38, 20 November 2009 (UTC)

Marmaduke, please do correct any grammar or spelling mistakes in the main article of course, and if you can propose any better wording or way of avoiding jargon please do so.--Andrew Lancaster (talk) 08:22, 20 November 2009 (UTC)

It means he is extremely hesitant to remove the jargon, and keeps adding unnecessary and redundant jargon back. He doesn't realize that an outsider simply will not trudge past (also known as SRY10831.2), I had delegated all this ISOGG stuff and second names to footnotes, but he continues to revert these things, and he has a problem with WP:MOS.PB666  22:35, 20 November 2009 (UTC)

To assist editors who should by all means work on this, let me summarize a few things:-

Version before editing of PB666 started yesterday did contain some of the problems noted above. (I have since corrected those.) It was actually broken into several paragraphs, but PB666 believes that Misplaced Pages policy is to make paragraphs long rather than short.

The naming systems commonly used for this haplogroup remains inconsistent in different published sources. Although it has not yet used much in published surveys, the most comprehensive survey of the known mutations is listed by ISOGG, and an equivalent tree is given in Underhill et al. (2009).

Prior to 2009 the mutation SRY1532.2 (also known as SRY10831.2) was normally used to identify what was known as "R1a", and this is also how the term R1a is most often used in publications well into 2009.

However the term "R1a" is also now increasingly used to refer to a broader family including not only this "old" R1a, but also other related R1 (R-M173) lineages which have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".

I think the biggest change by PB666 apart from making one paragraph, is in the last bit. Comparing the two in isolation:-

OLD. However the term "R1a" is increasingly used to refer to a broader family. This includes the "old" R1a and certain lineages within R1* that have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2 moves from "R1a" to "R1a1"."

NEW.However the term "R1a" is also now increasingly used to refer to a broader family including not only this "old" R1a, but also other related R1 (R-M173) lineages which have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".

Finally please note that there was at least a start of discussion about this passage here. While discussion did not go ahead, there are some opinions there about possible issues tio be considered.--Andrew Lancaster (talk) 09:03, 20 November 2009 (UTC)

Discussion requested about an apparent attempt to improve wording

I would like to ask for comments about whether the following wording change is an improvement. Even better would be help from more editors with ALTERNATIVE ideas.

• Version at beginning of PDeitiker (PB666 editing session):R1 and R1a are "phylogenetic" names, names designed to show a position in a family tree, with for example R1 and R2 being branches of R, R1a and R1b being branches of R1, etc. The other way of naming a haplogroup is by the SNP mutations on the Y chromosome which are used to identify them, in the way that "M173" is named in R1-M173. There are also "paraclades". For example R1* men have mutation M173, but they have no other mutations which are yet used to identify branches of R1.
• Version at end of PDeitiker (PB666 editing session): R1 and R1a are "phylogenetic" names, names designed to show a position in a family tree. Names of single nucleotide polymorphisms (SNPs) can also be used to name clades. For example, the M173 SNPs currently identifies R1. Thus R1 can also be called "R-M173". Because new mutations are discovered that can insert branches within clades, the R1 subclades may move but the SNP defined R-snp names will remain more consistent. There are also "paraclades". For example R1* are R-M173, but SNPs that might define new subclades have not been yet been identified. Definition of clades within subclades can result in the insertion of new clades and changes in haplogroup family trees.

Comments made to justify changes include following, with my initial remarks added in bold:-

• Removed etc. not encyclopedic. Fair enough.
• single nucleotide polymorphism as per WP:MOS capitals. Apparently PB666 did not realize he was editing within a link concerning this point. The words he mentions are not in the visible text. But OK, no big deal.
• Removed mutations , redundant with SNP In other words geneticists know that all SNPs are mutations? But PB666 has said he is trying to minimize jargon and make the article accessible. For example he even argues that mentioning numbers like "7000 people tested" is too difficult for normal readers! I can not follow this logic, and I already reverted this aspect in the main article. If other people disagree with me please say so.
• That is not the only problem they have, GA status. I have no idea what this means, but this is a note PB666 inserted for one of his biggest changes. Can someone help me?
• avoid red-linksFair enough and easily fixed, although I note PB666 linked outside of wiki when a[REDACTED] link is available for paraphyly, I'll fix
• R1s position does not change so we can simply use R1. No idea what this refers to.
• Removed unnecessary fragment . This apparently refers to the explanatory words (which are not a fragment by normal definitions) ", with for example R1 and R2 being branches of R, R1a and R1b being branches of R1". Is it agreed by others that this example served no purpose?

WP:OWN clearly applies here. And Excessive bolding on talk pages is also inappropriate, some wikipedians remove excessively capitalized or bolded text from talk pages. You are becoming increasing irrational.PB666  13:41, 20 November 2009 (UTC)

Gee, I have never seen a person declared irrational because of a formatting choice before. To be honest I think accusing someone of being irrational for an obviously minor thing is a textbook example of several things mentioned in WP:CIVIL? I think the same can be said about accusing someone of ownership issues based on them asking other editors for opinions. Also see WP:AGF. Anyway, is there any chance at all that you might use this talk page in the intended manner, and work as per Misplaced Pages policies such WP:AGF etc? I have been posting here because that is what people are supposed to do in order to discuss varying opinions about edits.--Andrew Lancaster (talk) 14:13, 20 November 2009 (UTC)

There are generally agreed upon styles that go back to the days of the USENET that are found to be indicative of combative or non-cooperative style. One is the use of Allcaps, since USENET does not have bolding. Excessive bolding here is indicative of combative behavior. The fact that you deleted an entire section in which I replaced your un-favored bullet list (in fact you reverted completely several changes) in favor of your own is clearly indicative of WP:OWN. No-one here has agreed with you regarding the use of user unfriendly rs####### tags either, and you have not justified why you are singling out the Page's two SNPs, its almost a form of name discrimination. PB666  14:43, 20 November 2009 (UTC)

When you decide to WP:refactor your comments I will respond to them.PB666  15:01, 20 November 2009 (UTC)

Fine. Sorry about the bold type. Now, concerning the article, I raised some points, and I was wondering if you would discuss them?--Andrew Lancaster (talk) 15:44, 20 November 2009 (UTC)

Another request for comment about proposed rewording

I would like to ask for comments about whether the following wording change is an improvement. Even better would be help from more editors with ALTERNATIVE ideas.

• Version at beginning of PDeitiker (PB666 editing session):R1a1a (old R1a1) is defined in various articles by M17 or M198 (two mutations which always appear together so far).
• Version at end of PDeitiker (PB666 editing session):M17 or M198 currently define as R1a1a (old R1a1) each used as a marker identifying the same clade in different publications. These two SNPs always appear together.
• Version at beginning of PDeitiker (PB666 editing session):Such lineages make up the dominant majority of all R1a, and most statistical or other analysis is by definition focused upon it.
• Version at end of PDeitiker (PB666 editing session):These two SNPs always appear together. R1a1a is the dominant within the R-M420 clade, and most statistical or other analysis is by definition focused upon it.

The main changes were done with no edit comment at all . Is this an improvement?--Andrew Lancaster (talk) 12:30, 20 November 2009 (UTC)

New versions of the first sentence mentioned above...

• R1a1a (old R1a1) is defined in various articles by M17 or M198. (These two mutations which always appear together in studies so far.)

Still hoping other editors will make comments and edits still.--Andrew Lancaster (talk) 14:06, 20 November 2009 (UTC)

Should a major defining mutation name now be COMPLETELY REMOVED from the article mainspace

A major defining mutation in R1a has two names, both of which are commonly used ALONE, in major articles including articles passed around by testing companies to amateur genealogists to name one type of readership. This is confusing. But somehow the article needs to handle it. Of course I can understand that the article should not mention both names every time, however, after PB666's last session I notice that one of the two names is entirely removed from the main article is now only mentioned in a footnote and in an infobox. Is this really the ideal situation? It strikes me that any term which might actually be a common search term that people might use when looking for this article should always be mentioned in the main space of the article?

Comments please.--Andrew Lancaster (talk) 12:30, 20 November 2009 (UTC)

For now I have inserted it ONCE, in the special section on this subject: http://en.wikipedia.org/Haplogroup_R1a_%28Y-DNA%29#R1a1_.28R-SRY1532.2.29 --Andrew Lancaster (talk) 13:18, 20 November 2009 (UTC)

titles of sections about major R1a clades

Although PB666 has made numerous remarks about the need to make sure we use a standardized naming system for the clade names, I note he has now twice tried to put the alternative clade names in ALONE as the titles of the sections on the three main clades of R1a. See for the most recent reversion. This would mean that the main naming system used throughout this article and indeed everywhere else, would be dropped, taken out of sight even, just for those sub-section titles. An explanation would be required I think?--Andrew Lancaster (talk) 14:02, 20 November 2009 (UTC)

I noticed you deleted my section R1a1a clades even though the MOS guide clearly disfavors the bullet list style. From your point of view its about have a longer title than I think is warranted, In addition since there are two R1a, two R1a1, two R1a1a, it is better to use the unambiguous title (stated in the MOS as to be avoided) since we went through all the effort to define it. I want you to justify why you are deleting material advocated by the WP:MOS in preparation for the GA review. If you cannot I will revert everything to my last edit.PB666  14:49, 20 November 2009 (UTC)

Misplaced Pages:Wiktionary#Wiktionary

PB666  14:55, 20 November 2009 (UTC)

At some point are you going to stop going over the rail as I try to get the article to comply to wiki guidelines?PB666  14:56, 20 November 2009 (UTC)

Thanks for writing something but which Misplaced Pages guidelines are you talking about please? I can not match any of these remarks to edits...

• I did not reinsert bullet points. I am the one who converted the bullets to sub-section, at your request.
• I did not revert to the longer previous versions of the sub section headings. I made them as short as possible within the AGREED principle of keeping a logical and consistent naming system.
• I did not "delete" any sections, or anything else. I changed some things. I explained all changes.
• I did not make anything ambiguous. I think everything I did was clearly and obviously aimed at reducing ambiguity.
• I am not part of any project to prepare for any GA review which you keep mentioning. I am just working as a Misplaced Pages editor, and Misplaced Pages has no WP:DEADLINE
• I have not made any arguments that we can not link to sister wikis as a policy. I just mentioned that I found a better article to link to. Check the two options perhaps?

Especially your accusation of me "going off the rail" requires some sort of justification. WP:AGF--Andrew Lancaster (talk) 15:42, 20 November 2009 (UTC)

Some of these are incorrect and some are completely false.

There can be no doubt, you clearly have a problem complying with Misplaced Pages guidelines. If you cannot comply with[REDACTED] guidelines please stop editing.PB666  16:38, 20 November 2009 (UTC)

"*I did not reinsert bullet points. I am the one who converted the bullets to sub-section, at your request."

This is a false statement: you did indeed remove my WP:MOS edit and replaced it with your previous version.PB666  16:38, 20 November 2009 (UTC)

Thank you for providing that diff which clearly shows no bullet points. I just did exactly what I explained I was doing, standardizing the nomenclature to the standard version, which is in fact according to a principle we seemed to agree upon. Is there some sort of misunderstanding here?--Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)

My version
M17 or M198 currently define as R1a1a (old R1a1) each used as a marker identifying the same clade in different publications. These two SNPs always appear together. R1a1a is the dominant within the R-M420 clade, and most statistical or other analysis is by definition focused upon it. This clade also has some sub-clades of its own, although a large proportion of R-M17/R-M198 has however not yet been categorized into branches defined by mutations, and is therefore referred to as R1a1* (old nomenclature) or R1a1a* (new nomenclature). SNP mutations understood to be always occurring with M17 and M198 include M417, M512, M514, M515, and rs34297606.

====R1a1a subclades==== So far, 8 sub-clades of R1a1a are known, R1a1a1 to R1a1a8. However only three subclades are so far known to have significant frequencies, R1a1a3, R1a1a6 and R1a1a7. R1a1a3 was first identified as R1a1c (old nomenclature) and is defined by the M64.2, M87, and M204 SNPs is apparently rare, found in 1 of 117 males typed in southern Iran. R1a1a6, defined by M434, was announced in Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help). M434 was detected in 14 people (of how many tested) from Pakistan to Oman and is likely to reflect a recent mutation that took place in the area of Pakistan.

The largest defined subclade of R1a1a is R1a1a7. R1a1a7 is defined by M458 and was first described in Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help). M458 is found primarily Europe (What about north America?), with its highest frequencies in Central and Southern Poland. R1a1a7 has its own subclade, defined by the M334 marker.

Was reverted by you back to this:

====R1a1a (R-M17 or R-M198)==== R1a1a (old R1a1) is defined in various articles by M17 or M198 (two mutations which always appear together so far). SNP mutations understood to be always occurring with M17 and M198 include M417, M512, M514, M515, and rs34297606. Such lineages make up the dominant majority of all R1a, and most statistical or other analysis is by definition focused upon it. The vast majority of R1a1a has not yet been categorized into branches defined by mutations, and is therefore referred to as R1a1a*. However, this clade also has several known sub-clades of its own. So far, 8 sub-clades of R1a1a are defined, however only three subclades are so far known to have significant frequencies.

• R1a1c (old nomenclature) or R1a1a3 (defined by M64.2, M87, and M204) is apparently rare, found in 1 of 117 males typed in southern Iran.
• R1a1a6 (new nomenclature, defined by M434) was announced in Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help). It was found in 14 people from Pakistan to Oman and is likely to reflect a recent mutation that took place in the area of Pakistan.
• R1a1a7 (defined by M458) was announced in Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help) and is the largest sub-clade found so far. It is found almost entirely in Europe, with its highest frequencies in Central and Southern Poland. Part of this sub-clade is further distinguished as R1a1a7a (defined by M334). From 3667 tested samples taken from 60 Eurasian populations, Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help) found only the following:-

Oh those bullets. Until recently there were more important bullets in this section which was the focus (I understood of concern) and I converted those, in response to your concern. Concerning these smaller bullet points, I did indeed re-insert them. I think they work better than your version. If you think not, say why, without referring to some person or "rule" you do not represent any more than I do. Sorry for the misunderstanding though.--Andrew Lancaster (talk) 22:38, 20 November 2009 (UTC)

When you revert edits it is your responsibility to observe what you are reverting, to do otherwise creates havoc. As for why, find a featured or good article with bullets thrown around, or the table, as you have placed it under the bullets. Once done you need to give the good reason for having it instead of proper text.PB666  22:44, 20 November 2009 (UTC)

I clearly did know I put those particular bullets back in. I was confused by your talkpage description of what your concern was.Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

SO you admit you lied, and not its my fault you lied. Andrew, do we need to take this to arbitration? Again these types of behaviors are consistent with WP:OWN

Please do take this to arbitration if you think it is the right thing to do. You also recently implied that that I should be banned from Misplaced Pages. Did you mean it? If you meant it then do something. Please stop saying stuff like or indeed, please put your money where your mouth is and go make your case. I think the posting I am replying to can be one of the exhibits. Will you do it? Here's what I bet: you will not respond to this, but you'll keep making personal attacks claiming that I am a bad faith editor. And your will do this instead of working towards a better article, as a diversion. This has been your way of writing since your unilateral article split was botched and reversed.--Andrew Lancaster (talk) 12:58, 21 November 2009 (UTC)

Then you would bet incorrectly. I have put this issue of Sophian/Small Victory is to try to get you to realize that you are doing the same kinds of things which you did not like them doing. And again if its destructive to the evolution of the page you need to come to realize this. Way back, when I was asked to offer an opinion on conflict of interest I took your side, but at the same time I examined the variety of edits to the E1b1b page and found alot of the most 'disturbing' edits from an encyclopedic point of view, many of these edits were yours. I was forced to stop what I was working on and try to repair an extremely unencyclopedic page. I did not single out all of your edits but because maybe you did not have much of an edit history, but at some point you need to move forward from an entry level editor, to someone who has more focus on the goals of the encyclopedia. Again, if I have a molecular anthropology background and have difficulty reading Y_DNA pages, it means that the page has serious problems. Many of these pages do, not only edit warring that is going on, which are indefensible, but what high-level page editor for[REDACTED] is going to defend the pages, they are written in their totality, as you say, 'a dog's breakfast'. This process may be painful to you, however at some point I will make no more edits to any Y-DNA, I will not arbitrate discussions. The only pages I will work on are basic pages, for example Y-Chromosomal Adam and Haplogroup A and Haplogroup B pages because of their importance. You have an interest in E1b1b page, wouldn't you like to see it be promoted, maybe become a featured article that will be seen by millions of people, instead of the 200 or so folks a day? Its never going to get their if you do not make quality improvements.PB666  16:09, 21 November 2009 (UTC)

No, I bet correctly. You have not responded in any direct, clear, honorable or WP policy-guided way (make your accusations clear, or else drop them) and you have continued to write ad hominem, i.e., not saying justifying your edits in terms of quality or lack of quality, but for example in terms of how you claim to be qualified to put me through difficult editing experiences in order to educate me. (Where do you get that from?)

Your non-response concerning your accusations clearly also shows that you see no problem with making false statements about people in order to make a point - implying that I should be banned from Misplaced Pages is now explained as a way to get me to realize things.

Your behavior is wrong simply, but also totally in opposition to Misplaced Pages norms.--Andrew Lancaster (talk) 16:43, 21 November 2009 (UTC)

Tell you whats goig to happen now Andrew, I am going to make the changes I think are appropriate to the page, if I see you making major reversions or WP:OWN edits I will simply take the case to arbitration and we will draft this discussion into the evidence. Is that OK with you?PB666  11:35, 21 November 2009 (UTC)

The diff you pointed to and all previous discussion seemed to be implying that I reverted the creation of sub-sections from bullets which you demanded. My initial responses to you and requests for diffs also show this is what I meant. I think it might not be obvious to others that the discussion now obviously looks odd, because you wrote your more detailed response after responses to your response had been written - as per my complaints about your talkpage habits on numerous occasions. Coming back to the supposed point, MOS does not forbid all use of bullets, does not say ledes must be padded, etc etc.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

Grow up. Its like I am arguing with a 5 year old. The lead does not fit the criteria as a stand alone synopsis of the material. I know this because I posted it on the Molecular Anthropology portal and IT STUNK. As a result I added a minimal amount of structure to make it stand alone. You are obviously wrong on this issue, what you need to do is to go ask someone who has edited many good ledes what is wrong with the lede on this page, since you don't want to take my word for it. No more arguing Andrew, I am going to change the article and if you repeat what you did yesterday then the case is going directly to arbitration.PB666  11:35, 21 November 2009 (UTC)

You appear to be saying that the GA reviewing means we need to write not according to what make an article really good, but according to more formal rules which make even make presentation worse.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

This is an encyclopedia, it is an electronic encyclopedia. It is not a review article in Current Opinions in Bovine Excrement. What makes an article good is to assemble the article according to the guidelines so that Misplaced Pages has consistent standards. Once an article is marked as a good article it is translated to many other languages, distributed on other media, etc. IOW you have to compromise in order to get a validation that allows more people to see it.PB666  11:35, 21 November 2009 (UTC)

That seems to confirm then, that you see GA standards as a compromise with article quality. I am not interested in GA standards if that is true. (It obviously is not supposed to be true.)--Andrew Lancaster (talk) 12:58, 21 November 2009 (UTC)

Andrew, you are being pedantic, this is not primary literature, its not a human genetic workshop. The venuw is that it is a general purpose encyclopedia. You need to read WP:NOT

If this is true, then I choose not to aim at the later standards. I'll stick to real quality instead of GA review quality. If GA standards are really so formalized then I guess there is a chance that no haplogroup article will ever be seen as a top level article, which does not bother me at all. I guess there are a number of Wikipedians who think haplogroups are scientific arcana and do not even deserve to have Misplaced Pages articles.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

• Then you diminish wikipedia. The standard is it an encyclopedia. It is rather open, but you cannot force upon the page unencyclopedic information and say I will fight to keep this (what ever your cherished terminology or jargon is), and revert others who attempt to make it more encyclopedic. If you are clever you would say, I can compromise on this, I will explain the terminology I essentially need, I will limit the terminology to only the essential stuff, the other stuff I will note, and I will try to draft as many readers into my favorite subject, instead relying on those geeks out their who for whatever reason like to understand new and highly complicated lingo. Some of those geeks, not so well rounded, would like nothing otherwise than trash your page, and since you have so few broad wikipedians who will engage your page, then were will your page defenders be? Why did you join Wikiproject Human genetic history if you intent was not to make it more encyclopedic? Sounds to me like a contradition.PB666  16:38, 21 November 2009 (UTC)

You know very well that I simply disagree with what you say that Misplaced Pages policy says and means. I also disagree with you concerning your personal judgement of your own ability to judge any type of writing style including the "encyclopedic" one. There is therefore no point talking as if the disagreement is based on anything else. That is a waste of time.

Your insistence that people should treat your word as gospel if they want to communicate with you (even though your knowledge this subject is dodgy, and your writing terrible) has managed to convince no one, and I think your (fake) threat to call in arbitration would be one way to get a broader perspective on how unusual your opinions are. But actually you know already how weak your case is, or else you could make your case in a clear and consistent way.

How weird is your position? Let's see. You say your latest edits and positions were about removing and reducing jargon and yet we see...

• Changing sub-section titles to use a nomenclature different from all the literature and the body and title of the article (in direct contravention of discussion which has been had on this exact matter of the years at WP:HGH). Y
• You changed the jargon word "family tree" to the common everyday word "phylogenetics". :)
• "region specific distributions" - couldn't find a normal way to say it?
• "evolved from a male-line ancestor who was in haplogroup R1" replaced by the much simpler (not) construction "R1a evolved along a Y-chromosomal lineage (a male or paternal line of ancestry) from haplogroup R1" (you did at least explain your argument that "male line" is jargon.)--Andrew Lancaster (talk) 17:40, 21 November 2009 (UTC)

"*I did not revert to the longer previous versions of the sub section headings. I made them as short as possible within the AGREED principle of keeping a logical and consistent naming system."

Again this is a false statement, you have not read the guidelines. The naming guidelines with titles and sections that are pertinent are:

• Titles should be short—preferably fewer than ten words.

• Change a heading only after careful consideration, because this will break section links to it within the same article and from other articles. If changing a heading, try to locate and fix broken links.

• Special characters—such as the slash (/), plus sign (+), braces ({ }), and square brackets ()—are avoided . . . | |WP:MOS

Again, thanks, but this time you provide no diff. Therefore I will simply note what I can...

• I did not make any titles with anything approaching 10 words. All were short by any standard.
• I gave careful consideration, and explained my edits both while editing, and on this talkpage, starting this discussion which you are now in.
• I did not insert, but I did in fact remove, some unusual characters. I can use the same diff you gave: --Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)

I believe you should also back your accusation up that I did supposedly "revert to the longer previous versions of the sub section headings". Please give a diff or diffs showing the reversion to the old versions.--Andrew Lancaster (talk) 18:05, 20 November 2009 (UTC)

The reason I changed the section headers is quite simple, as you outlined in the above paragraph, one set of names are subject to change, this will cause a disruption of wiki-links if it occurs. As this required the use of a second set of names, which you justified,[REDACTED] prefers the section names that will be most stable. Once we get established section names we do not want them to change.PB666  16:38, 20 November 2009 (UTC)

See the start of this talkpage section where I have explained things. The most common names used everywhere are the phylogenetic names. It is also how other articles and this article are written on Misplaced Pages. I personally always tend to use the mutational names in correspondence, but I do not force the article to follow my personal habits. I find it striking how much you are in conflict with your own talkpage remarks here. For example: "R1-M173, R-M173 and M173 are used on different occasions, use only one terminology." --Andrew Lancaster (talk) 17:46, 20 November 2009 (UTC)

"I did not "delete" any sections, or anything else. I changed some things. I explained all changes.

Another false statement: see above. You need to start paying better attention to what you are doing. If I had split off R1a1a article the article would be done now and in compliance with WP:MOS, you are simply creating the need for more edits and more reorganization because you refuse to read the MOS. Get your act together!PB666  16:52, 20 November 2009 (UTC)

"See above" where please? Please give a diff for what I deleted.--Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)

You have given no justification for adding the rs###### style in these two instances other than your preference and your discrimination against Page's last name, it clearly adds more unnecessary and more complex jargon to the page, it disrupts the cladogram making it much less professional looking relative to the pre-2009 cladogram, and it introduces a level of jargon that is covered by three other levels, Rx, R-M###, and M###. In addition your meddling with the cladograms has thrice screwed up the formattin which I have had to repair. You obviously don't know how to work with templates, and yet you insist on making changes that make them less professional. It is clearly not either neccesary or encyclopedic. Underhill, a professional, made the choice in the figure as to which was most appropriate to public consumption, he deligated the rs###### to the supplimentary material. Why do you think your judgement is better than his on the issue? You clearly have a 'special' problem with the label, but you cannot provide any support that it is mislabeled. Again WP:OWN issue here.PB666  16:52, 20 November 2009 (UTC)

To answer your multiple points here (it would be great if you could stick to one thing at a time, I have tried to make it easy):-

• I did give justification for the rs mutation name. See . You have been extraordinarily unclear in your responses, to put it mildly.
• rs reference numbers are standard and this particular one is cited in several articles.
• Despite what you say, Underhill et al. also uses it, as you know. It is not true to say those authors chose one name over the other. In one paper they used the standard name and an unusual name. In other articles the same authors use only the standard name.
• Concerning my bumbling on the cladogram, sorry. However I asked you to fix it because it was showing R-M420 as a parallel clade to R-SRYSRY1532.2 and you refused, which represents no past, present or future proposal of anyone. Eventually we got it right though.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)

My edits were in compliance with WP:MOS. your reversions were not.PB666  16:38, 20 November 2009 (UTC)

Without going through the rest of the issues, even after giving you a suitable draft your new sections:

1. were not logically organized (See your talk page),
2. continue to rely on material that will be critiques during review (list of fractions in text, list of mutations in text, non-compliance with a naming standard rs#######),
3. had colloquial (non-formal, non-professional) wording,
4. and etc.

If you do not start following the MOS I will simply revert your edits back to my last edit. Your edits are clearly exemplary of WP:OWN because you do not want review the guidelines before making edits and/or reverting edits and will be a stumbling block for GA review. You must familiarize yourself with WP:MOS in progressing further until you do so further discussion here is futile. Am I making myself clear?PB666  16:38, 20 November 2009 (UTC)

In all honesty I struggle to find any case where you have been able to define any edit of mine as against the Manual of Style.Andrew Lancaster (talk)

Then you should probably stop editing and reverting peoples edits and read the entire WP:MOS. I assure you that the referees have read MOS. Whether or not you struggle is irrelevant, you have reverted edits based on MOS recommendations and you are not acting in good faith in defending those edits.PB666  21:21, 20 November 2009 (UTC)

Please stop speaking on behalf of people who you are obviously not speaking on behalf of. If YOU say I should do something better, then YOU should explain it in your own name.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

I note that you have switched to referring to MOS as more or less yourself in third person, just as you have recently been referring to the GA review process as yourself in third person, and previously it was the grading process to which we all had to defer when accepting your opinions. Andrew Lancaster (talk)

This is a transparently deceptive statement. While I am trying to get this page ready for external critique,(the best way is to go over WP:MOS guidelines) this is the best defense that you have for your actions. Please cease. Your edit of the cladogram is clearly a POV edit.PB666  21:21, 20 November 2009 (UTC)

Well, as you keep saying, I may also be irrational. But I did my best to explain my thinking and ask you to explain yours. That's all any of us can do. It is much less than you did.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

Referring to yourself in third person, or making up imaginary authorities, is sometimes a way to avoid normal discussion. I think it is important that you avoid that temptation.Andrew Lancaster (talk)

Another clearly diversive remark. Once nominated articles will be reviewed, it takes about 8 days for the process to begin, OK. I have no involvement in outside review, you appear to be unfamiliar with the process for improving wikipages beyond a certain point (that would be start class it appears). The person who might review this page has already left a comment on this page, 'too much unexplained jargon'. PB666  21:21, 20 November 2009 (UTC)

Although I do not care at all about any review you have asked for, it sounds like we'd probably both agree with him, which would imply that we should work on remedies. So what is your point? You seem to be saying that you have inside knowledge to say that this comment was specifically directed at something I wrote or which I defended? Or what exactly is your point?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

In contrast, concerning your proposal to revert all my edits, this sort of thing happens on Misplaced Pages and as you know there really are procedures and rules which come into play and take over from our conversation. If that is where you are headed then I find that unfortunate.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)

I am giving you ample opportunity to make the requested corrections in your own words. Since you are here arguing with me then it indicates you desire not to make the change and therefore justifies the reversion. Simply stated you are acting in abstinence to the guidelines.]  21:21, 20 November 2009 (UTC)

That is "simply stated" as only you could simply state. I am in abstinence now of understanding what you mean. What are you talking about? Aren't you complaining strongly about the fact that I have been editing in my own words? Haven't you been reverting me and going to extraordinary lengths to stop me doing this?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

I would also like you to demonstrate your good faith and back-up the rest of your above assertions that I was being "incorrect" or "completely false" in my above summary. The points you have not explained:---Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)

Did you not look at the diff. Clear as day, I converted your bullet list into a new section and you reverted my edit, back to the bullet list. No reasonable explanation was given, not attempt to merge your edits into my edits. This is something I would expect of Small Victory or Sophian. This is a 'lack of good faith' reversion, and on top of that you've now lied about it, and you are pretending it did not happen? Right now the only difference between you, Sophian and Small victory is that they have been banned and you have not.PB666  21:21, 20 November 2009 (UTC)

Can you please have a look at the diff you quoted then and make sure you picked the right one?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

• You apparently claim that I made the sub-section headings ambiguous. Please give a diff.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)

Again another false statement, I did not singly claim you made them ambiguous I claimed that they were not in best compliance with Wiki guidelines, 'Short as possible, free of special characters as possible, and section heads least likely to need later revision'. What I stated is that the section heads should be about topics in that section, since some section refer to old R1x in one section and new R1x in the other section that was more ambiguous than the carefully defined (finally) R-M### names. These names are therefore preferred, well defined, unlikely to change in the future, reasonable short, needing only one special character, a "-". This makes internal and section linking the easiest and most reliable. In mentioning what you said about R-M clades on my talk-page and on this page (in quotes) that '100s of undetected mutations' you, yourself, admit that these section heads may change in the future. I personally don't like 'E-M123' terminology, however they best fit the WP:MOS#section and since they best fit WP:MOS it is my opinion that these are the only headings that should be used. At some point are you going to stop misrepresenting things I said and start improving the page?PB666  21:21, 20 November 2009 (UTC)

• You apparently claim I was lying about not being "part of any project to prepare for any GA review which you keep mentioning" and/or about the fact that "I am just working as a Misplaced Pages editor, and Misplaced Pages has no WP:DEADLINE". Please explain what that accusation means. Should be good.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)

If you are going to use WP:DEADLINE as an excuse for reverting edits that are compliance, improvement toward MOS guidance, knowing that these issues are going to be the focus of the review then I would say you are acting in bad faith. Making false statements saying you did not do it, then it is certain you are acting in bad faith.PB666  21:21, 20 November 2009 (UTC)

• You also apparently claim that I have arguments that we can not link to sister wikis as a policy. Or perhaps you are claiming my lie is to say that I just mentioned that I found a better article to link to.

The diff was already provided above. Explain why you made these reversions? A and B.PB666  21:21, 20 November 2009 (UTC)

PD, are you going to repair the above so that it can be read and responded to? I was writing responses when as so often I found you'd come back to de-construct your own work so much that it can hardly be read.--Andrew Lancaster (talk) 22:06, 20 November 2009 (UTC)

Haven't you learned yet how to merge edits?PB666  22:11, 20 November 2009 (UTC)

That's not the point. You've created a dog's breakfast above. If I insert answers and make it more complex no one including us will ever be able to read it. What is that quote now doing hanging in the middle of everything? And an even bigger problem is your habit of continuing to edit your remarks after they have been responded to. Most people do not post so many layers of "draft" over such a long period as you do. As a person responding I therefore need to at least know when you've stopped changing your mind and come up with your "real" response. In frustration at your lack of simple courtesy I do now insert responses above.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)

You did the same thing on the main page, I had to merge edits on three occasions and after all of that you reverted it. Good for the goose, good for the gander. Are you going to respond to Marmaduke's critique of unnecessary jargon?PB666 

I see no connection between the two things. On a talkpage it is obviously a major aim that your formatting should allow people to see how a discussion develops. Inserting new explanations after old ones have already been answered, or signing them days later, is just obviously wrong. When editing articles themselves the main aim is making the article better. The biggest problems we are having there is that you make very little effort to write carefully, or read the structure and context of a section where you are writing, even though a large % of your edits are supposedly copyedits. I do not believe our editing style is the same in this respect. Concerning Marmaduke's comment are you referring to the one I already replied to at length, and where you have already posted a sarcastic rejoined? What is your point, if any? I'd say the point is that normal editing is being held up and confused by numerous issues arising from your constant demands that we must obey your strange interpretation of the MOS (padded ledes, no bullets at all, no numbers etc) or else you will start making massive unilateral changes that will need to be cleaned up.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

Writing Issues

PB666  11:22, 21 November 2009 (UTC)

I see no connection between the two things. On a talkpage it is obviously a major aim that your formatting should allow people to see how a discussion develops. Inserting new explanations after old ones have already been answered, or signing them days later, is just obviously wrong. When editing articles themselves the main aim is making the article better. The biggest problems we are having there is that you make very little effort to write carefully, or read the structure and context of a section where you are writing, even though a large % of your edits are supposedly copyedits.

Although I do not care at all about any review you have asked for, it sounds like we'd probably both agree with him, which would imply that we should work on remedies. So what is your point? You seem to be saying that you have inside knowledge to say that this comment was specifically directed at something I wrote or which I defended? Or what exactly is your point?

"I do not believe our editing style is the same in this respect".

Your right, Andrew, I am trying to make this article more encyclopedic, and you appear to be doing the exact opposite. There are two ways to hurt wikipedia. One way is to do what Sopian and Small Victory were doing, to try to push extremist views into the encyclopedia while forcing out countering points of views, or what you are doing, which is to ignore the advice of others, fail to follow the guidelines, which compounds itself by all the Y-DNA pages, and interfere with other when they do. I come back to areas I have worked on and rewrite them. I do have examples that are good articles and featured articles, many B-class articles.PB666  11:22, 21 November 2009 (UTC)

Secondarily your rewriting, that I went over and reorganized was not logically constructed and had a great many error. Again black cat calling kettle black. And if you go back into the page history of this page you added to sections to the page and failed to sign them, after I critiqued on stylistic issues, you later signed those. Don't think I didn't notice these. More or less this is a diversion from the fact that you made false statements and you cannot swallow it.PB666  11:22, 21 November 2009 (UTC)

Concerning Marmaduke's comment are you referring to the one I already replied to at length, and where you have already posted a sarcastic rejoined? What is your point, if any? I'd say the point is that normal editing is being held up and confused by numerous issues arising from your constant demands that we must obey your strange interpretation of the MOS (padded ledes, no bullets at all, no numbers etc) or else you will start making massive unilateral changes that will need to be cleaned up.

That reply is inadequate, there is a whole host of jargon that is going to be criticized, you can't put one pea in a soup and call it split pea soup. And, BTW, I am not of a false belief that nothing I have added will be criticized some things may not be obvious to me, but you have many things in your writings that our obviously jargon and you are stubbornly protecting them. So the when the review is done that is what I am going to say, we have one editor, and here, Andrew Lancaster and here are the diffs, that stubbornly protects un-encyclopedic wording.PB666  11:22, 21 November 2009 (UTC)

So now you are not only re-editing your comments after they are replied to, but also re-editing mine. One way or another it is clear that this conversation is going no where. You are repeating yourself and effectively your main argument is "what you say is what you are". I stand by my claims that:

• You have consistently spoken vaguely of me breaching some sort of rule without ever being able to explain a case in detail. (The exact rules or third parties you claim to speak for keep changing.) For example here note the "whole host of jargon that is going to be criticized". Not by you, right? But by the bad cop? Why not just explain the case for your preferences case by case like other people do?

• Who says bullets are not allowed? Cite.
• Who says ledes must be a minimum length, and need to be padded if they are two short? Just you.
• Who says that numbers are to be avoided in all situations? No-one. Even the rules you supposedly believe in keep changing.

• While I would much rather simply get on with editing, I believe I have tried to explain my ideas in every case, in detail, with diffs. You have not done the same. In fact I feel some regret about having wasted time on that. Indeed, as a result, you have now even accused me of ranting and dwelling on details.
• Furthermore your technique of quoting WP policies and MOS with your words interspersed but unmarked, plus your way of re-editing both your own talkpages remarks as well as the responses of others, is dishonest and shows that sensible communication is not possible.

I am open to communication if it seems possible in the future.--Andrew Lancaster (talk) 12:51, 21 November 2009 (UTC)

PB666, I notice you have decided to go massively unilateral again, as threatened for some time, even spelling mistakes and jargon are being re-inserted. Not one compromise to the proposals of other editors is being considered. You have indeed been saying that you are going to start edit warring soon. The reviewer you keep mentioning will no doubt be pleased with the stability of consensus of the article, which is I think one of the first things they look at?--Andrew Lancaster (talk) 13:16, 21 November 2009 (UTC)

The sections I worked on have been proofed by MSWORD grammar and spelling checker, in addition I fixed your grammatical errors also, MSWORD does not know how wrote or miswrote, also repaired broken links in the page, also fixed a number of other issues. I did alot of things, but massivel unilateral is not the case, I have more or less repaired, simplified, sometimes favoring your lingo (for example mutation versus snp) over mine, which-ever is the best suited to comply with MOS and the dejargonizing effort. And you should note that I have pointed to sections that it was in the best interest to change, but I left in your version, even correcting minor spelling an grammar errors in those sections. Now if you go in and screw it up, that is an issue I will bring up at some later point, but at least there is a diff now, so that if the referee makes alot of comments, I will simply show the diff and say, this is what Andrew changed. You have to make a choice now Andrew, are you going to evolve, or remain stubborn.PB666  14:02, 21 November 2009 (UTC)

I should point out, Andrew that when pages go through the GA process, they often pick up concerned editors who will protect pages from lower quality reversions. Again, please re-edit my wording as you see fit, but please also read the MOS completely before doing so that you are lowering the quality that is there, and if you did a mindless revert as you previously did it will go to arbitration.PB666  15:40, 21 November 2009 (UTC)

I should make a few points: Haplogroup is not well defined on the page. MSWORD picked it up as Jargon.PB666  14:02, 21 November 2009 (UTC)

Haplogroup is indeed a type of jargon, but how do you write a genetics article without even this level of jargon. The first paragraph of the whole article explains what a haplogroup is in very simple terms unless you've changed it. MSWORD simply can't be the right standard here.--Andrew Lancaster (talk) 15:58, 21 November 2009 (UTC)

I completely agree, however the jargon we need to make sure this it is indeed explained fully. The question is, not to you Andrew is but to someone less familiar, are we doing an adequate job of explaining the jargon. We need an outside opinion for that purpose.PB666  22:58, 21 November 2009 (UTC)

Table issues

I have added two tables and Andrew has added one table to the page. There are problems. The table comparing STRs which I have added, and STR are discussed in the aspect of diversity, but no description of STR have been added to the page.

The Table Andrew has added needs to be improved for readability, if he doesn't mind I will improve it. I can inprove according to the standard wiki-table style or the style of my other tables.PB666  15:40, 21 November 2009 (UTC)

If you improve a table why would I be against that? If there is something about the improvement that others might think makes it worse, then of course you could explain about that.--Andrew Lancaster (talk) 16:00, 21 November 2009 (UTC)

When I make a table I have a final style in mind, I don't know what you have in mind? you can correct some of the problems yourself. If you specific the border style, you need to then specific a width to separate out the columns. It is relative simple to insert at the top row of each column width = 40px (or whatever number of pixels provides the best fit)

Major re-write of phylogeny and other sections needs feedback

Rather than continuing a circular discussion, or taking up the gauntlet of Phil's edit war invitation, I'd like to call for other editors to now take over this article.

I did a lot of edits on this article in recent times, and was then stopped (before I think the job was finished) by a stream of complaints starting with a complaint that I and another editor objected to a proposal to try to discuss R1a1 and R1a1a in two different articles. Discussion, as you can see on this talk page, took up a lot of time, but failed.

Now PDeitiker has, as threatened, taken over and done a large number of edits in directions he knows that the other editors active on this article disagree with. We seem to be moving further apart, and that's why I call in others.

This history means it is luckily easy to post a diff for two proposed versions, which can be easily compared, and perhaps merged, or else one can be chosen over the other, or whatever:

Most of the differences and disagreements reflect format and wording issues, and the question of "what is encyclopedic?" Please other potential editors, note that what is needed right now is judgement on formatting and wording, not on the details of the science (although in some cases, the right wording or formatting might require some knowledge). The publication of two recent articles on R1a was perhaps a trigger for all the work that led to this situation, but most integration of the basic facts is done (although of course this can still be improved also.--Andrew Lancaster (talk) 15:55, 21 November 2009 (UTC)

I think that would be appreciated at this point. PB666  16:46, 21 November 2009 (UTC)

I think a diff of each of the proposed versions would be very helpful for editors who are now joining the discussion. --Athenean (talk) 19:42, 21 November 2009 (UTC)

Since his posting this morning, I have made some improvements both in the text and also improved Andrew's table but have some questions I left in the text for him that he can repair His last version versus my last version and I really appreciate some review, thanks.PB666  19:58, 21 November 2009 (UTC)

1. ^ Cite error: The named reference Underhill2009 was invoked but never defined (see the help page).
2. Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help)
3. Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help)
4. see : Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help)
5. see : Underhill et al. (2009) harvcoltxt error: no target: CITEREFUnderhill_et_al.2009 (help)
6. ^ Regueiro et al. (2006) harvcoltxt error: no target: CITEREFRegueiro_et_al.2006 (help)